Invasive Species Compendium

Detailed coverage of invasive species threatening livelihoods and the environment worldwide

Datasheet

sheep and goat pox

Toolbox

Datasheet

sheep and goat pox

Summary

  • Last modified
  • 11 July 2018
  • Datasheet Type(s)
  • Animal Disease
  • Preferred Scientific Name
  • sheep and goat pox
  • Overview
  • Sheep pox and goat pox (SGPX) were regarded as different diseases in the past (Bennet et al., 1944). Goat pox was describ...

Don't need the entire report?

Generate a print friendly version containing only the sections you need.

Generate report

Pictures

Top of page
PictureTitleCaptionCopyright
TitleSymptoms
Caption
CopyrightDivision of Virology, Indian Veterinary Research Institute Campus, Mukteswar
SymptomsDivision of Virology, Indian Veterinary Research Institute Campus, Mukteswar
Close-up of skin lesions. Goat.
TitleSymptoms
CaptionClose-up of skin lesions. Goat.
CopyrightDivision of Virology, Indian Veterinary Research Institute Campus, Mukteswar
Close-up of skin lesions. Goat.
SymptomsClose-up of skin lesions. Goat.Division of Virology, Indian Veterinary Research Institute Campus, Mukteswar
Lung lesions.
TitlePathology
CaptionLung lesions.
CopyrightDivision of Virology, Indian Veterinary Research Institute Campus, Mukteswar
Lung lesions.
PathologyLung lesions.Division of Virology, Indian Veterinary Research Institute Campus, Mukteswar
Lung lesions.
TitlePathology
CaptionLung lesions.
CopyrightDivision of Virology, Indian Veterinary Research Institute Campus, Mukteswar
Lung lesions.
PathologyLung lesions.Division of Virology, Indian Veterinary Research Institute Campus, Mukteswar
Sheep showing skin popules due to capripox.
TitleSheep pox. Symptoms.
CaptionSheep showing skin popules due to capripox.
CopyrightR. Paul Kitching
Sheep showing skin popules due to capripox.
Sheep pox. Symptoms.Sheep showing skin popules due to capripox.R. Paul Kitching
Goat with capripox showing papules rhinitis and conjunctivitis.
TitleGoat pox. Symptoms
CaptionGoat with capripox showing papules rhinitis and conjunctivitis.
CopyrightR. Paul Kitching
Goat with capripox showing papules rhinitis and conjunctivitis.
Goat pox. SymptomsGoat with capripox showing papules rhinitis and conjunctivitis.R. Paul Kitching
TitlePolymerase chain reaction (PCR) test
Caption
CopyrightDivision of Virology, Indian Veterinary Research Institute Campus, Mukteswar
Polymerase chain reaction (PCR) testDivision of Virology, Indian Veterinary Research Institute Campus, Mukteswar
TitleAGPT
Caption
CopyrightDivision of Virology, Indian Veterinary Research Institute Campus, Mukteswar
AGPTDivision of Virology, Indian Veterinary Research Institute Campus, Mukteswar
TitleLatex agglutination (LA) test
Caption
CopyrightDivision of Virology, Indian Veterinary Research Institute Campus, Mukteswar
Latex agglutination (LA) testDivision of Virology, Indian Veterinary Research Institute Campus, Mukteswar
TitleCounter immunoelectrophoresis (CIE) test
Caption
CopyrightDivision of Virology, Indian Veterinary Research Institute Campus, Mukteswar
Counter immunoelectrophoresis (CIE) testDivision of Virology, Indian Veterinary Research Institute Campus, Mukteswar
Necrotic (gray) lesions in the skin of a goat.
TitleExternal symptoms
CaptionNecrotic (gray) lesions in the skin of a goat.
Copyright©USDA-2002/Foreign Animal Diseases Training Set/USDA-Animal and Plant Health Inspection Service (APHIS)
Necrotic (gray) lesions in the skin of a goat.
External symptomsNecrotic (gray) lesions in the skin of a goat.©USDA-2002/Foreign Animal Diseases Training Set/USDA-Animal and Plant Health Inspection Service (APHIS)
The black areas are dried necrotic sheep pox lesions.
TitleExternal symptoms
CaptionThe black areas are dried necrotic sheep pox lesions.
Copyright©USDA-2002/Foreign Animal Diseases Training Set/USDA-Animal and Plant Health Inspection Service (APHIS)
The black areas are dried necrotic sheep pox lesions.
External symptomsThe black areas are dried necrotic sheep pox lesions.©USDA-2002/Foreign Animal Diseases Training Set/USDA-Animal and Plant Health Inspection Service (APHIS)
The diffusely distributed atelectatic areas in lung from a sheep with acute SP are the result of SP virus replication.
TitlePathology
CaptionThe diffusely distributed atelectatic areas in lung from a sheep with acute SP are the result of SP virus replication.
Copyright©USDA-2002/Foreign Animal Diseases Training Set/USDA-Animal and Plant Health Inspection Service (APHIS)
The diffusely distributed atelectatic areas in lung from a sheep with acute SP are the result of SP virus replication.
PathologyThe diffusely distributed atelectatic areas in lung from a sheep with acute SP are the result of SP virus replication.©USDA-2002/Foreign Animal Diseases Training Set/USDA-Animal and Plant Health Inspection Service (APHIS)
Sheep pox lesions on the tail of a sheep. The macular stage (M) progresses to the papular stage (P) which is erythematous, edematous, and has central necrosis.
TitleExternal symptoms
CaptionSheep pox lesions on the tail of a sheep. The macular stage (M) progresses to the papular stage (P) which is erythematous, edematous, and has central necrosis.
Copyright©USDA-2002/Foreign Animal Diseases Training Set/USDA-Animal and Plant Health Inspection Service (APHIS)
Sheep pox lesions on the tail of a sheep. The macular stage (M) progresses to the papular stage (P) which is erythematous, edematous, and has central necrosis.
External symptomsSheep pox lesions on the tail of a sheep. The macular stage (M) progresses to the papular stage (P) which is erythematous, edematous, and has central necrosis.©USDA-2002/Foreign Animal Diseases Training Set/USDA-Animal and Plant Health Inspection Service (APHIS)

Identity

Top of page

Preferred Scientific Name

  • sheep and goat pox

International Common Names

  • English: caprine variola; capripox; goat pox, goatpox; goatpox; goat-pox; goat-specific pox; GPV infection; Indian goat dermatitis; sheep pox; sheeppox; sheep-pox; stone pox; variola of goats; virulent sheep and goat pox, capripoxvirus - exotic

English acronym

  • SGPX

Overview

Top of page

Sheep pox and goat pox (SGPX) were regarded as different diseases in the past (Bennet et al., 1944). Goat pox was described in detail in veterinary texts dating to around 200 AD, and has been widespread since early times. Hansen reported goat pox in 1879 from Norway (Rafyi and Ramyar, 1959). It was recorded during the First World War in Macedonia and became enzootic during 1926 with a mortality rate of 15% (Blanc et al., 1929). Both sheep and goat pox are caused by capripoxviruses (Sharma and Dhanda, 1972; Davies, 1976: Black et al., 1986) of the family Poxviridae (Murphy et al., 1995). These are enveloped, double stranded DNA viruses, which show different levels of host adaptation for either sheep or goats in different parts of the world. Sheep and goat pox are now considered to be a single disease entity. The various host-adapted strains are indistinguishable serologically but molecular studies have revealed differences (Black et al., 1986; Gershon and Black, 1988). Black et al. (1986) and Gershon and Black (1988) also found some strains to have restriction endonuclease digest patterns with intermediate patterns showing characteristics of both sheep and goat strains. Some strains may show serious disease in one host and mild or only local lesions in the other (Singh et al., 1979). Others have a similar pathogenicity for both sheep and goats. Goats are generally less severely affected than sheep.

SGPX is probably the most serious infectious disease of small ruminants in many parts of the world (Singh et al., 1979). The disease inflicts substantial losses in terms of reduced productivity and lower quality of wool and leather. It poses a major obstacle in the intensive rearing of sheep and goats and also greatly hampers international trade. It is suggested that goat pox is the most important of all pox diseases of domestic animals causing high mortality in kids and significant economic losses (Upton, 1980; Agriculture Western Australia, 1999). It was eradicated from continental Europe in the 20th century, although periodic introductions have occurred into France (1964) from North Africa, to Italy (1983), and, more recently, to Greece and Bulgaria (1988) (OIE Reports). There have been later OIE reports of outbreaks in Greece in the 1990's and 2007. South Eastern Europe is now clear, but the Near and Middle East, Asia and Africa north of the equator are affected. The disease is characterized by skin lesions, occurring over the whole of the body, or restricted to the hairless areas of the perineum, head, groin, axillae and mammary glands. The lesions are also found in the oropharynx, in the lungs, alimentary tract and other organs. The morbidity and mortality rates can be very high, especially in totally susceptible populations with many neonates and young animals. The disease is highly infectious and the virus is resistant to desiccation, it remains viable in the environment and in scab debris for a long time (Bennet et al 1944; Singh et al 1979; Davies 1981).

Sheep and goat pox are found in the extensive pastoral systems in the arid and semi arid zones of Asia and Africa, but also in the more settled livestock management systems in SE Europe and Asia. Animal movements for grazing and watering, for shearing and marketing, and trade movements are all associated with the mixing of large numbers of animals, which increases the risk of transmission. Infected flocks remain a source of the virus for several months after apparent recovery.

Sheep and goat pox is on the list of diseases notifiable to the World Organisation for Animal Health (OIE). The distribution section contains data from OIE's WAHID Interface database on disease occurrence. Please see the AHPC library for further information on this disease from OIE, including the International Animal Health Code and the Manual of Standards for Diagnostic Tests and Vaccines. Also see the website: www.oie.int.

Host Animals

Top of page
Animal nameContextLife stageSystem
Capra hircus (goats)Domesticated hostSheep & Goats: All Stages
Ovis aries (sheep)Domesticated hostSheep & Goats: All Stages

Hosts/Species Affected

Top of page

Capripoxviruses only infect ungulates, and most strains of virus tend to cause clinical disease in only one species. Sheep and goats are the main hosts at risk from SGPX. Virtually all of the known species of goats and sheep from different parts of the world are susceptible to host-specific and other strains of the virus. Only local lesions may follow the inoculation of some of the well adapted, host-specific strains in the alternative host, such as a host-adapted sheep pox into goats or vice versa. Of some of the viruses found in goats, Kenyan and Yemen isolates, as well as an Oman sheep isolate, infect sheep and goats equally (Davies, 1976; Kitching and Taylor, 1985b). Usually, Middle East and Indian isolates are host specific and do not infect sheep (Bakos and Brag, 1957; Sharma and Dhanda, 1972; Tantawi et al., 1980; Kitching, 1983; Soman et al., 1985; Datta and Soman, 1991). A few strains may also produce lesions in rabbits and reindeer (Nandi and Rao, 1997).

There is some variation in the susceptibility of different breeds and strains of sheep and goats to SGPX virus. This difference appears to be of genetic origin. It is possible that the host preference shown by different strains is due to their adaptation to either goats or sheep in a restricted geographical area. Goat pox affects goats of all ages, sex and breeds, but the disease is more common and severe in younger animals, lactating females and older animals. European breeds are particularly susceptible. The disease causes high mortality, particularly if the infection is associated with other diseases such as peste des petits ruminants, or bad management. No disease syndrome has been described in wild ungulate populations.

Some strains of SGPX virus, will produce local necrotic lesions at the site of inoculation in cattle. This is particularly notable with the East African strains of SGPX virus, which are very closely related to lumpy skin disease virus. Some mild generalization of the infection may follow the use of the Kenyan modified live virus SGPX vaccine strain for the prophylaxis of lumpy skin disease in Bos taurus breeds exotic to Africa (Bos indicus breeds are relatively resistant). The vaccine strain is, however, extremely safe and immunogenic for sheep and goats (Davies and Mbugwa, 1985).

Sheep and goat pox is a disease common throughout the extensive arid and semi-arid grasslands of Africa, and throughout the similar habitat in Eastern Europe and Asia, including the Indian subcontinent and China. The steppe is a similar type of habitat that is expansive in Eastern Europe and West Asia. Animal husbandry in this environment involves extensive animal movement in search of grazing, and this movement may vary from season to season and year to year. There is also considerable movement for trade and other purposes. All such animal movements provide opportunity for the inter-mixing of infected, with uninfected flocks, and this allows further propagation of the disease. Such movement is also liable to be increased at the peak times for trade, such as those associated with the religious festivals. It may also be driven by drought and water shortages, when more flocks aggregate at water holes. Shearing is a period when further virus propagation can occur, as teams move from flock to flock.

Systems Affected

Top of page digestive diseases of small ruminants
respiratory diseases of small ruminants
skin and ocular diseases of small ruminants
urinary tract and renal diseases of small ruminants

Distribution

Top of page

Sheep and goat pox is found in Asia, including the Indian subcontinent and China, and in Africa. The infection was eradicated from Great Britain in 1866 and subsequently most western European countries have eliminated the disease by the slaughter of infected animals and the enforcement of strict movement control measures. Irregular introductions occur from the adjacent endemic countries. Sporadic outbreaks still occur in Eastern European Mediterranean islands, probably originating from imported animals (House, 1992).

Sheep and goat pox is endemic in the Mahgreb countries in North Africa, and in the sahelian and soudano-sahelian zones of East, Central and West Africa. It occurs just south of the equator in some African countries but not much further south. It is endemic in the arid- and semi-arid zones of East Africa and the Horn of Africa. It is also endemic in Iran, Iraq, Turkey, Egypt, Sudan, Syria, southeast Russia, Mongolia, India, Pakistan, Afghanistan, Nepal, Vietnam, Chinese Taipei and China. It has occurred in many other countries. Many of these countries produce vaccines against sheep pox and against goat pox, and some conduct national disease control programmes.

According to the AU-IBAR the number of African countries affected by sheep pox and goat pox (SGPX) had, before 2011, shown an increasing trend for three consecutive years. The number of countries reportedly affected by SGPX in 2011 reduced remarkably from the previous year. In 2011, twelve countries reported occurrence of SGPX in their territories, which is a 46% reduction from the 26 countries affected by the disease in 2010 (AU-IBAR, 2011). There is no plausible explanation for this decrease in reporting as there is no ongoing continental program against SGPX although there might be national interventions against the disease. The top three countries that recorded the highest number of outbreaks in 2011 include Ethiopia (223), Somalia (170) and Algeria (44). Overall, a total of 541 epidemiological units were affected on the continent involving 9932 cases and 1619 deaths, with a case fatality rate of 16.3%.

Countries reporting sheep pox and goat pox to AU-IBAR in 2011 

Country

Outbreaks

Cases

Deaths

Slaughtered

Destroyed

Algeria

44

306

14

0

0

Cameroon

2

15

0

0

 

Ethiopia

223

4827

815

90

 

Ghana

1

2

0

0

0

Kenya

2

9

0

0

0

Lesotho

1

5

0

0

0

Niger

41

945

235

NS

NS

Nigeria

2

33

7

9

5

Senegal

7

410

28

0

0

Somalia

170

2393

324

49

47

Sudan

29

859

185

5

0

Tunisia

19

128

11

5

15

Total (12)

541

9932

1619

158

67

NS: Not specified

In common with many other TADs, the monthly distribution of occurrence of SGPX reported to AU-IBAR in 2011 did not show any temporal trend with outbreaks reported throughout the year with no marked seasonal variability. It is difficult to provide any plausible explanation for this kind of temporal trend, not only for SGPX but also for many other reported TADs. Focused studies need to be carried out to elucidate as to why there is no clear seasonal pattern for disease occurrence, particularly for those diseases whose epidemiology is underpinned by climatic parameters.

Distribution Table

Top of page

The distribution in this summary table is based on all the information available. When several references are cited, they may give conflicting information on the status. Further details may be available for individual references in the Distribution Table Details section which can be selected by going to Generate Report.

Continent/Country/RegionDistributionLast ReportedOriginFirst ReportedInvasiveReferenceNotes

Asia

AfghanistanPresentNULLOIE, 1984; Kitching, 1994; OIE, 2009
ArmeniaDisease not reportedOIE, 2009
AzerbaijanDisease not reportedOIE, 2009
BahrainPresentNULLOIE, 1998; OIE, 2009
BangladeshPresentNULLKitching et al., 1987a; Nooruddin et al., 1987; OIE, 1997; OIE, 2009
BhutanNo information availableOIE, 2009
Brunei DarussalamDisease not reportedOIE Handistatus, 2005
CambodiaNo information availableOIE, 2009
ChinaRestricted distributionOIE, 2009
-FujianPresentOIE, 1999
-GansuPresentOIE, 1999
-HebeiPresentOIE, 1999
-HeilongjiangPresentOIE, 1999
-HenanWidespreadOIE, 1999
-Hong KongDisease never reportedOIE, 2009
-HubeiPresentOIE, 1999
-JiangxiPresentOIE, 1998
-JilinPresentOIE, 1998
-LiaoningPresentOIE, 1997
-NingxiaPresentOIE, 1999
-QinghaiWidespreadOIE, 1999
-ShaanxiPresentOIE, 1997
-ShandongPresentOIE, 1997
-ShanxiPresentOIE, 1999
-SichuanPresentOIE, 1994
-YunnanPresentOIE, 1997
Georgia (Republic of)Last reported1997OIE Handistatus, 2005
IndiaRestricted distributionOIE, 2009
-Andhra PradeshWidespreadRao et al., 1998; OIE, 1999
-BiharPresentSoman et al., 1985
-DelhiPresentOIE, 1992
-GujaratPresentOIE, 1998
-HaryanaPresentOIE, 1997
-Himachal PradeshLocalisedOIE, 1994; Batta et al., 1999
-KarnatakaWidespreadOIE, 1999
-KeralaPresentOIE, 1994
-LakshadweepPresentOIE, 1998
-Madhya PradeshPresentJoshi et al., 1999
-MaharashtraWidespreadOIE, 1998
-NagalandOIE, 1995
-OdishaWidespreadBandyopadhyay et al., 1984; OIE, 1998
-RajasthanPresentNagpal et al., 1990; OIE, 1999
-Tamil NaduWidespreadOIE, 1998
-Uttar PradeshPresentDas et al., 1978
-West BengalWidespreadSaha et al., 1985; Bhowmik et al., 1986; OIE, 1997
IndonesiaDisease not reportedOIE, 2009
IranPresentNULLFernandez, 1991; OIE, 1999; OIE, 2009
IraqPresentNULLKarim, 1983; Hussein et al., 1989; OIE, 2009
IsraelDisease not reported200805OIE, 1999; OIE, 2009
JapanDisease not reportedOIE, 2009
JordanRestricted distributionNULLAbo-Shehada, 1990; OIE, 1999; OIE, 2009
KazakhstanDisease not reportedOIE, 2009
Korea, DPRDisease not reportedOIE Handistatus, 2005
Korea, Republic ofDisease not reportedOIE, 2009
KuwaitPresentNULLFernandez, 1991; OIE, 1999; OIE, 2009
KyrgyzstanDisease not reportedNULLOIE, 1996; OIE, 2009
LaosDisease never reportedOIE, 2009
LebanonAbsent, reported but not confirmedNULLOIE, 1993; OIE, 2009
MalaysiaDisease not reported1935Kuppuswamy, 1936; OIE, 2009
-Peninsular MalaysiaDisease never reportedOIE Handistatus, 2005
-SabahDisease never reportedOIE Handistatus, 2005
-SarawakDisease never reportedOIE Handistatus, 2005
MaldivesDisease never reportedOIE, 2012
MongoliaPresentNULLOIE, 1999; OIE, 2009
MyanmarNo information availableNULLOIE, 1990; OIE, 2009
NepalPresentNULLKitching, 1994; OIE, 2009
OmanPresentNULLKitching et al., 1987a; Fernandez, 1991; OIE, 1999; OIE, 2009
PakistanPresentNULLKitching, 1994; OIE, 1999; OIE, 2009
PhilippinesDisease never reportedOIE, 2009
QatarDisease not reportedNULLOIE, 1999; OIE, 2009
Russian Federation
-Russia (Asia)WidespreadOIE, 1995; OIE, 1996; OIE, 1997; OIE, 1999
Saudi ArabiaDisease not reported2004OIE, 2003; OIE, 2009
SingaporeDisease never reportedOIE, 2009
Sri LankaDisease not reported199610OIE, 1996; OIE, 2009
SyriaDisease not reportedNULLOIE, 1991; OIE, 1994; OIE, 2009
TaiwanDisease never reportedOIE Handistatus, 2005
TajikistanPresentNULLVannovski, 1955; OIE, 1997; OIE, 2009
ThailandDisease never reportedOIE, 2009
TurkeyPresentNULLFernandez, 1991; OIE, 1992; OIE, 1999; OIE, 2009
TurkmenistanLast reported2000OIE Handistatus, 2005
United Arab EmiratesPresentNULLOIE, 1998; OIE, 2009
UzbekistanLast reported1995OIE Handistatus, 2005
VietnamPresentOIE, 2009
YemenPresentNULLKitching et al., 1986a; OIE, 2009

Africa

AlgeriaPresentOIE, 2012
AngolaDisease never reportedOIE, 2012
BeninNo information availableNULLOIE, 1986; OIE, 2009
BotswanaDisease never reportedOIE, 2009
Burkina FasoPresentNULLOIE, 1998; OIE, 2009
BurundiDisease not reportedOIE, 2012
CameroonReported present or known to be presentOIE, 1999; OIE Handistatus, 2005
Cape VerdeLast reported1988OIE Handistatus, 2005
Central African RepublicDisease not reportedOIE, 2012
ChadNo information availableNULLBidjeh et al., 1990; Lancelot et al., 1994; OIE, 1998; OIE, 2009
CongoNo information availableOIE, 2009
Congo Democratic RepublicDisease not reportedOIE Handistatus, 2005
Côte d'IvoireDisease not reportedOIE, 1999; OIE Handistatus, 2005
DjiboutiDisease not reportedOIE, 2012
EgyptLast reported1999Soad et al., 1996; OIE, 2012
EritreaPresentOIE, 2012
EthiopiaPresentOIE, 2012
GabonNo information availableOIE, 2009
GambiaNo information availableOIE, 2009
GhanaDisease not reportedOIE, 2012
GuineaNo information availableNULLOIE, 1994; OIE, 2009
Guinea-BissauNo information availableOIE, 2009
KenyaDisease not reported2003Kilelu, 1991; OIE, 2012
LesothoDisease not reportedOIE, 2009
LibyaPresentOIE, 2012
MadagascarDisease never reportedOIE, 2012
MalawiDisease never reportedOIE, 2012
MaliDisease not reported2007OIE, 1995; OIE, 2009
MauritaniaReported present or known to be presentOIE, 1998
MauritiusDisease not reportedOIE, 2012
MoroccoPresentFernandez, 1991; OIE, 1995; OIE, 2012
MozambiqueDisease not reportedNULLOIE, 1997; OIE, 2009
NamibiaDisease not reportedOIE, 2009
NigerReported present or known to be presentOIE, 1991; OIE, 1994; OIE Handistatus, 2005
NigeriaDisease not reported2004Okoh and Obasaju, 1983; Okaiyeto et al., 1995; OIE, 2009
RéunionDisease never reportedOIE Handistatus, 2005
RwandaDisease not reportedOIE, 2009
Sao Tome and PrincipeDisease not reportedOIE Handistatus, 2005
SenegalPresentOIE, 1999; OIE, 2012
SeychellesDisease not reportedOIE, 2012
SomaliaPresentOIE, 2012
South AfricaDisease never reportedOIE, 2009
SudanPresentMohamed et al., 1982; Hajer et al., 1988; OIE, 1998; OIE, 2012
SwazilandDisease not reportedOIE, 2009
TanzaniaDisease not reportedNULLKavishe, 1988; Maeda and Kasonta, 1996; OIE, 2009
TogoNo information availableNULLOIE, 1995; OIE, 2009
TunisiaPresentNULLOIE, 1998; OIE, 2009
UgandaNo information availableNULLOIE, 1985; OIE, 2009
ZambiaOIE, 2012
ZimbabweDisease never reportedOIE, 2009

North America

BermudaDisease not reportedOIE Handistatus, 2005
CanadaDisease never reportedOIE, 2009
GreenlandDisease never reportedOIE, 2009
MexicoDisease never reportedOIE, 2009
USADisease never reportedNULLRenshaw and Dodd, 1978; OIE, 2009
-WashingtonPresentRenshaw and Dodd, 1978

Central America and Caribbean

BarbadosDisease never reportedOIE Handistatus, 2005
BelizeDisease never reportedOIE, 2009
British Virgin IslandsDisease never reportedOIE Handistatus, 2005
Cayman IslandsDisease never reportedOIE Handistatus, 2005
Costa RicaDisease never reportedOIE, 2009
CubaDisease never reportedOIE, 2009
CuraçaoDisease not reportedOIE Handistatus, 2005
DominicaDisease not reportedOIE Handistatus, 2005
Dominican RepublicDisease never reportedOIE, 2009
El SalvadorDisease never reportedOIE, 2009
GuadeloupeDisease never reportedOIE, 2009
GuatemalaDisease never reportedOIE, 2009
HaitiDisease never reportedOIE, 2009
HondurasDisease never reportedOIE, 2009
JamaicaDisease never reportedOIE, 2009
MartiniqueDisease never reportedOIE, 2009
NicaraguaDisease never reportedOIE, 2009
PanamaDisease never reportedOIE, 2009
Saint Kitts and NevisDisease never reportedOIE Handistatus, 2005
Saint Vincent and the GrenadinesDisease never reportedOIE Handistatus, 2005
Trinidad and TobagoDisease never reportedOIE Handistatus, 2005

South America

ArgentinaDisease never reportedOIE, 2009
BoliviaDisease never reportedOIE, 2009
BrazilDisease never reportedOIE, 2009
ChileDisease never reportedOIE, 2009
ColombiaDisease never reportedOIE, 2009
EcuadorDisease never reportedOIE, 2009
Falkland IslandsDisease never reportedOIE Handistatus, 2005
French GuianaDisease not reportedOIE, 2009
GuyanaDisease never reportedOIE Handistatus, 2005
ParaguayDisease never reportedOIE Handistatus, 2005
PeruDisease never reportedOIE, 2009
UruguayDisease never reportedOIE, 2009
VenezuelaDisease never reportedOIE, 2009

Europe

AlbaniaDisease not reportedOIE, 2009
AndorraLast reported1952OIE Handistatus, 2005
AustriaDisease not reportedOIE, 2009
BelarusDisease never reportedOIE, 2009
BelgiumDisease never reportedOIE, 2009
Bosnia-HercegovinaLast reported1955OIE Handistatus, 2005
BulgariaDisease not reported199609OIE, 1996; OIE, 2009
CroatiaDisease not reportedOIE, 2009
CyprusDisease not reportedOIE, 2009
Czech RepublicDisease not reportedOIE, 2009
DenmarkDisease not reportedOIE, 2009
EstoniaDisease never reportedOIE, 2009
FinlandDisease never reportedOIE, 2009
FranceDisease not reportedOIE, 2009
GermanyDisease not reportedOIE, 2009
GreeceDisease not reported2007Kitching, 1994; OIE, 1997; OIE, 2009
HungaryDisease not reportedOIE, 2009
IcelandDisease never reportedOIE, 2009
IrelandDisease not reportedOIE, 2009
Isle of Man (UK)Disease never reportedOIE Handistatus, 2005
ItalyDisease not reported198305Kitching, 1994; OIE, 2009
JerseyDisease never reportedOIE Handistatus, 2005
LatviaDisease never reportedOIE, 2009
LiechtensteinDisease not reportedOIE, 2009
LithuaniaDisease never reportedOIE, 2009
LuxembourgDisease not reportedOIE, 2009
MacedoniaDisease never reportedOIE, 2009
MaltaDisease never reportedOIE, 2009
MoldovaLast reported1994OIE Handistatus, 2005
MontenegroDisease not reportedOIE, 2009
NetherlandsDisease not reportedOIE, 2009
NorwayDisease not reported1882Slagsvold, 1938; Hutyra et al., 1949; OIE, 2009
PolandDisease not reportedOIE, 2009
PortugalDisease not reportedOIE, 2009
RomaniaDisease not reportedOIE, 2009
Russian FederationRestricted distributionOIE, 2009
-Russia (Europe)WidespreadOIE, 1995; OIE, 1996; OIE, 1997; OIE, 1999
SerbiaNo information availableOIE, 2009
SlovakiaDisease not reportedOIE, 2009
SloveniaDisease never reportedOIE, 2009
SpainDisease not reportedOIE, 2009
SwedenDisease not reported1934Bakos and Brag, 1957; OIE, 2009
SwitzerlandDisease never reportedOIE, 2009
UKDisease not reportedOIE, 2009
-Northern IrelandLast reported1850OIE Handistatus, 2005
UkraineDisease never reportedOIE, 2009
Yugoslavia (former)Disease never reportedOIE Handistatus, 2005
Yugoslavia (Serbia and Montenegro)Last reported1955OIE Handistatus, 2005

Oceania

AustraliaDisease never reportedOIE, 2009
French PolynesiaDisease never reportedOIE, 2009
New CaledoniaDisease never reportedOIE, 2009
New ZealandDisease never reportedOIE, 2009
SamoaDisease never reportedOIE Handistatus, 2005
VanuatuDisease never reportedOIE Handistatus, 2005
Wallis and Futuna IslandsNo information availableOIE Handistatus, 2005

Pathology

Top of page

The basic pathology of lesions of SGPX is vasculitis, thrombosis with oedema and necrosis. This process occurs in all the affected tissues. The lesions of sheep and goat pox are not restricted to the skin, but may also affect any of the internal organs, in particular the gastrointestinal tract from the mouth and tongue to the anus, and the respiratory tract. In skin, lesions may involve the full depth of the epidermis, dermis and adjacent muscle. Lymph nodes are oedematous with much inflammation and hyperplasia. The mucous epithelium of the eyes, nose and mouth hard and soft palate, and respiratory tract all develop similar lesions. Such lesions on the nares and muzzle can result in a cellulitis with severe swelling that greatly restricts respiration. The eyelids may be badly affected by sheep pox lesions and swelling may cause them to completely close. Severe respiratory distress may result from lesions in the pharynx, on the epiglottis and in the trachea. Sloughing of infected tissues into the respiratory tract causes secondary inhalation pneumonia.

Characteristic vasculitis, thrombosis and necrosis in the lesions throughout the various affected tissues can be seen on microscopic examination. Histopathology of the affected skin includes an initial epithelial hyperplasia followed by coagulation necrosis as thrombi develop in the blood vessels supplying the papules. Histiocytes accumulate in the areas of the papules and the chromatin of the nuclei of infected cells marginates. The cells appear stellate as their boundaries become poorly defined, and many undergo hydropic degeneration with the formation of microvesicles. Infected epithelial cells and histiocytes show intracytoplasmic inclusion bodies, which stain from eosinophilic to light blue. They are frequently found singly, but there may be several, and often have a clear halo around them. The affected histiocytes show a degenerative change with loss of nuclear chromatin. These cells are the 'celles claveleuse' that are pathognomonic for SGPX (Borrel, 1903a; Plowright et al., 1959; Murray et al., 1973).

Postmortem lesions usually include tracheal congestion, lentil-sized, bullet-shaped nodules and white patches on lungs, inflamed spleen and lymph nodes with greying white necrotic lesions and increased quantity of blood-tinged pleural fluid. In some animals, lesions develop in the lungs as multiple consolidated areas (Kitching and Taylor, 1985b; Isloor et al., 1991). The lesions in the lungs are irregularly shaped grey foci of 5-50 mm in diameter, which appear as a result of spread in the blood stream. They are very similar to secondary carcinomata and consist of aggregations of the 'celles claveleuse'. Lesions start as red foci of inflammation, they enlarge and gradually become infiltrated with the inflammatory cells, which are characteristic for sheep pox lesions wherever they occur in the animal. Furthermore, affected lung tissue is characterized by congestion, red hepatization and exudation, coagulative necrosis surrounded by a marked zone of inflammatory reaction and thickening of interlobular septae. Depletion of lymphocyte population in paracortical regions and absence of germinal centres in spleen and lymph nodes are also observed (Isloor et al., 1991; Saha et al., 1991).

The lymph nodes in cases of SGPX are grossly enlarged by up to 5-times, with oedema, cellular proliferation, congestion and haemorrhage. The lesions may be found in the oesophagus, rumen, abomasum, and large and small intestine. The liver and kidney may have whitish lesions of 3-15 mm in diameter. There may be lesions in the urogenital tract, heart, muscle, in the prepuce and sheath, in the vulva and vagina. Rarely, abortions may occur in pregnant females and the stillborn foetuses may have skin lesions caused by the SGPX virus.

Diagnosis

Top of page

Introduction

A tentative clinical diagnosis can be made in the field. This can be based on the occurrence of a highly infectious febrile disease, associated with prolonged fever, lymphadenitis, an eruption of skin lesions, which may be of papules, vesicles or scabby, necrotic, irregularly round lesions of 3-15 mm in diameter. Oropharyngeal lesions may also occur, together with pneumonia. The mortality can be very high in newborns and 25-50% in older age groups. Specimens to submit for laboratory diagnosis (virus isolation) can include biopsy tissue material, but postmortem specimens collected from one or two severely affected acute cases are preferable. Biopsy specimens should include samples from two or three lesions at the papular or vesicular stage. Skin lesions should be clipped, and cleansed with a non-disinfectant soap and rinsed with water. Blood (in EDTA for PCR test and in heparin for virus isolation) should be collected aseptically from early febrile cases. Postmortem specimens should include lesions from skin, turbinates, trachea, lungs and enlarged lymph nodes. Specimens that will arrive at the testing laboratory within 24 hours can be transported with wet ice; if more than 1 day will elapse, then specimens should be packed in dry ice or in appropriate transport medium such as 20-50% glycerol in phosphate buffered saline. For pathology, preserve portions of the collected tissues in 10% buffered formalin and forward to the laboratory unfrozen. For serology, collect serum from at least three 'early' and three chronic cases. Collect a convalescent serum from the same 'early' cases 14-21 days later (House, 1992).

Clinical diagnosis

Clinical cases vary from mild to severe

  • Fever, depression, off feed, arched back

  • Cutaneous eruption beginning with erythematous areas (macules) especially noticeable in hair or wool-free parts of the body

  • Lesions evolve into papules

Papulo-vesicular form


  • Papules desiccate and form crusts that are easy to remove

  • Rarely, papules may transform into vesicles. After rupture of vesicles, a thick crust covers the lesions

Nodular form ('stone pox')


  • Papules give rise to nodules involving all the layers of the skin and the subcutaneous tissue

  • Necrosis and sloughing of the nodules leaves a hairless scar

Lesions


  • Skin lesions: congestion, haemorrhage, oedema, vasculitis and necrosis

  • Lymph nodes draining infected areas: enlargement (up to eight times normal size) and lymphoid proliferation

  • Pox lesions: on mucous membranes of the eyes, mouth, nose, pharynx, epiglottis, trachea, on the rumenal and abomasal mucosae, the muzzle, nares, in the vulva, prepuce, testicles, udder, and teats

  • Lung lesions: severe and extensive pox lesions, focal and uniformly distributed throughout the lungs

Differential diagnosis


  • Bluetongue

  • Peste des petits ruminants

  • Contagious ecthyma

  • Photosensitization

  • Dermatophilosis

  • Insect bites

  • Parasitic pneumonia

  • Caseous lymphadenitis

  • Mange (scabies)

Laboratory diagnosis

The laboratory diagnosis of sheep and goat pox is carried out by a wide variety of tests. Initially, laboratory testing was mainly confined to agar gel immunodiffusion for which conventionally raised antiserum against infectious capripoxvirus suspension was commonly used. Subsequently, a soluble antigen fraction, which is not infectious, effectively replaced the infectious virus in various serological tests (Rao and Negi, 1997; Singh et al., 1998). Its use in various tests can avoid the risk of spread of virus from the laboratory; it helps in the safe handling and supply of diagnostic reagents to various destinations. A number of tests have recently evolved which employ the soluble antigen fraction and its antiserum for the diagnosis of capripoxvirus. The detection of capripoxvirus or its antigens may be performed by virus isolation and neutralization in cell culture, fluorescent antibody or electron microscopy.

Nevertheless, the diagnosis of SGPX by classical virological or serological techniques dependent on live viruses is not suitable in countries where the virus is exotic and live viruses are not available. Hence, the latest molecular biology tools such as polymerase chain reaction (PCR) -based diagnostic methods are extremely useful for the detection of the viral nucleic acid of capripoxvirus in those countries. The following tests can be routinely employed for the diagnosis of sheep pox and goat pox in field samples.

Transmission electron microscopy

Laboratory confirmation of SGPX may be readily made by transmission electron microscopy. The vesicular tissue or fluid, or a skin biopsy sample may be used as a source of virus, which may be examined directly on a grid by staining with phospho-tungstic acid. The large brick- or oval-shaped virions of capripoxvirus are readily distinguishable. Misleading results may be obtained by the detection of parapoxvirus in apparently normal skin, although parapoxvirus virions are very distinct from those of capripoxvirus.

Virus isolation

If tissue culture systems are available, then the virus may be isolated in primary lamb kidney or testis cultures. Some cell lines such as BHK21 C 13 may also be used, but they are less sensitive. Commercially available lamb testis cell line (OA3.Ts) has been evaluated for propagation of capripoxvirus isolates (Babiuk et al., 2007). The lesion tissue is homogenized in a pestle with sterile sand in an antibiotic-containing buffer such as phosphate buffered saline. A 10-20% suspension is then frozen and thawed three times or sonicated to release intracellular virus. After centrifugation, the supernate is used to inoculate monolayers of testis or kidney cells.  In case a bacterial contamination of the samples is suspected, supernatant can be filtered through 0.45 µm pore size filter, prior to the inoculation of the sample to cell monolayer. The typical cell inclusions become obvious 3-5 days after inoculation and the pox antigen may be specifically identified with direct or indirect immunofluorescent or immunoperoxidase staining (Davies, 1978; Gulbahar et al., 2000) or PCR (Mangana et al., 1999). Characteristic cytopathic effect (CPE) can be detected approximately 4 to 7 days after the inoculation of the virus. A second passage should be carried out for those cell cultures that appear to be negative in the first passage.

Agar Gel Immunodiffusion (AGID) Test

A gel diffusion technique for diagnosis of goat pox was applied as early as the 1960s (Bhambani and Krishnamurthy, 1963). Subsequently, use of [35S]methionine-labeled antigen preparations considerably improved the sensitivity of AGID for capripoxvirus antibody detection (Kitching et al., 1986b). AGID is very simple and can be applied anywhere in the remote regions as it requires bare minimum laboratory facilities. However, although it is cheaper, it is relatively insensitive and cross-reacts with parapoxvirus (Rao et al., 1997a).

Counter immunoelectrophoresis (CIE) test

The CIE test is more sensitive and rapid than AGID in the diagnosis of sheep and goat pox (Sharma et al., 1988a). Normal saline solution may exceptionally be used as an alternative to barbitone buffer (Rao et al., 1999). It is a simple and economical test.

Latex agglutination test

Latex agglutination assays have been successfully used in the detection of various antigen-antibody systems and have proved to be rapid, simple-to-perform, and need no expensive equipment (Rao et al., 1997c). The test is comparable in sensitivity to the CIE test for the diagnosis of sheep and goat pox in field samples (Rao et al., 1996b) and can be applied at farm level.

Reverse phase passive haemagglutination (RPHA) test

Capripoxviruses are non-haemagglutinating (Matthews, 1982). Therefore, indirect haemagglutination tests like RPHA using sensitized sheep erythrocytes are useful in the laboratory diagnosis of goat pox and the RPHA is more sensitive than AGID and CIE tests (Tiwari et al., 1995;Rao and Negi, 1997). Other agglutination tests that include coagglutination (Joshi et al., 1989) and spot agglutination (Tiwari et al., 1996) are also available for the simple and rapid diagnosis of sheep and goat pox.

Single radial haemolysis (SRH) test

The test is simple and has been successfully employed to diagnose sheep and goat pox (Tiwari and Negi, 1996a).

Enzyme-linked immunosorbent assays (ELISAs)

Different members of Capripoxvirus-genus (lumpy skin disease virus, sheep pox and goat pox viruses) cannot be distinguished serologically. Various antibody ELISAs have been developed for capripoxviruses in the past with limited success. The earliest ELISA utilised a protein encoded by P32 (vaccinia H3L homoloque) as an antigen (Carn et al., 1994; Heine et al., 1999). More recently, an indirect ELISA was developed based on whole heat-inactivated sheep pox virus as an antigen (Babiuk et al., 2009). Unfortunately, due to difficulties in producing the inactivated antigen in sufficient quantities, this assay is currently not available for use in the open market. In another study 42 open reading frames (ORF) of the capripoxvirus genome were evaluated for their antigenic potential and 2 ORFs encoding virion core proteins were selected as the best candidate antigens for use in ELISA. These proteins were then expressed in Escherichia coli and used as antigens for an indirect ELISA (Bowden et al., 2009). An ELISA based on a synthetic peptide targeting the major antigen P32 has been described for the detection of sheep pox and goat pox antibodies (Tian et al., 2010).

Antigen capture ELISA test systems can also be used for virus identification but samples should be collected early in the course of the disease (first 5 days) and the test is relatively insensitive (Carn, 1995; Heine et al., 1999; Rao et al., 1997, 1999). The test will not detect less than 10 3 TCID 50 per 50 µl of virus. Alternatively, an immunocapture ELISA can be regarded as a relatively simple assay for the detection of capripoxvirus antigens in scab suspensions (Rao et al., 1997d), but this assay too has limitations as it is best used only in combination with a CIE test for accurate and confirmative diagnosis.

A dot-ELISA, which is carried out on nitrocellulose strips or paper, is a valuable addition to the battery of diagnostics for SGPX and is more sensitive than SRH (Tiwari and Negi, 1996b) and CIE tests (Sedhukhan et al., 1998). Avidin-biotin ELISA for the detection of antibodies to capripoxvirus in sera uses an isolated fraction of the soluble antigens, which substantially minimizes the background reaction in the assay (Rao et al., 1999). This is a reliable test that may be used to assess immunity to goat pox (and possibly sheep pox), and can be used in epidemiological studies. Though efficient diagnostic tools, all ELISAs are relatively expensive and also demand technical expertise to handle the assays.

Immunofluorescent/immunoperoxidase assays

Specific antibody to capripoxvirus may be detected by indirect immunofluorescent/immunoperoxidase assays or by ELISA test systems. There are some cross-reactions with other poxviruses but the extent of these can be evaluated and the tests have proved valuable in disease investigations (Woodroofe and Fenner, 1962; Sharma and Dhanda, 1971).

Virus serum neutralization test systems

These may also be used in microtitre assays (Davies and Otema, 1978). The antibody persists for at least 3 years. A summary of this test can be found, along with those of other diagnostic techniques for sheep and goat poxvirus, in the OIE Manual of Diagnostic Tests and Vaccines for Terrestrial Animals 2010, Volume 2, Chapter 2.7.14. Sheep Pox and Goat Pox.

Hypersensitivity test

There is also a hypersensitivity cellular response to capripoxvirus infections (Capstick, 1962; Das et al., 1986), which may be detected by antigen inoculated intra-dermally (Davies, 1991; Bachh et al., 1997; Anil Sachan et al., 2000).

Polymerase chain reaction (PCR)

Although sensitive, ELISA and virus isolation in cell culture fail to detect virus particles that are bound to neutralizing antibody (Ireland and Binepal, 1998), and the sensitivity of a precipitation or an agglutination test is usually low.

The tentative diagnosis of sheep pox and goat pox is usually based on characteristic clinical signs. PCR tests provide the most rapid and accurate laboratory confirmation of sheep pox and goat pox diagnosis. Several conventional PCR (Heine et al., 1999; Ireland and Binepal, 1998; Mangana-Vougiouka et al., 1999; Orlova et al., 2006; Tuppurainen et al., 2005; Zheng et al., 2007) and real-time PCR methods (Balinsky et al., 2008; Bowden et al., 2008) have been described. Although gel-based PCR is more time- and labour- consuming than real-time PCR, it is a cheap and reliable method, and is therefore useful in countries with limited resource. A gel-based PCR method using primers 5’TTTCCTGATTTTTCTTACTAT3’ (21mer) and 5’AAATTATATACGTAAATAAC3’ (20mer) (Ireland and Binepal, 1998) for the gene encoding viral attachment protein is effective for the diagnosis of capripoxvirus in suspected skin samples (Nandi and Rao, 2000). In addition, a real-time PCR method for the simultaneous detection, quantitation and differentiation of capripoxviruses has been described by Lamien et al. (2011).

Field laboratory diagnosis

In field laboratories, the ELISA test systems may be most widely applicable. The agar gel double diffusion test gives false positive reactions with other poxviruses, such as the parapoxvirus of orf, which is common. The test may be helpful in field laboratories if parapox control test systems are also used, but they share soluble antigens. Histopathology may also be an option. Most of the other test systems require some virological facilities and expertise.

Capripoxvirus infections have been confused with contagious pustular dermatitis, with sarcoptic or psoroptic mange, streptothricosis, bluetongue, peste des petits ruminants and caseous lymphadenitis. Many of these can be eliminated by simple staining techniques. Orf rarely produces the prolonged fever and pneumonic lesions, with generalized skin lesions, which are found with SGPX. However, it is the most commonly encountered disease for differential diagnosis and laboratory samples should be taken for confirmation. Peste des petits ruminants causes severe gastro-enteritis and the mouth lesions are white and necrotic. Bluetongue produces swelling of the muzzle with erythema of the skin rather than focal necrotic changes. Laboratory testing is necessary to confirm diagnosis of the latter two diseases.

Immunology of the disease

Infection with poxviruses evokes both humoral and cell-mediated immune responses (Pandey et al., 1969; Negi et al., 1988; Deshmukh and Gujar, 1992). Heterologous vaccines generally work well. The relative importance of circulating antibodies versus cytotoxic T-lymphocytes in the suppression of the infection is not fully understood. However, it is quite clear that on the appearance of circulating anti-viral antibodies, infection subsides in hosts (Cho and Wenner, 1973). Circulating antibody derived through natural infection or vaccination may limit spread of virus in the animal, but it is the cell-mediated immune response that eliminates infection (Carn, 1993). However, the immune status of a previously infected or vaccinated animal cannot be related to serum levels of neutralizing antibody (Kitching, 1986a), and current serological tests are unable to distinguish reliably between susceptible and immune animals.

List of Symptoms/Signs

Top of page
SignLife StagesType
Digestive Signs / Anorexia, loss or decreased appetite, not nursing, off feed Sheep & Goats:All Stages Sign
Digestive Signs / Congestion oral mucous membranes, erythema, redness oral mucosa Sheep & Goats:All Stages Sign
Digestive Signs / Diarrhoea Sheep & Goats:Hogget,Sheep & Goats:Mature female,Sheep & Goats:Breeding male Sign
Digestive Signs / Difficulty in prehending or chewing food Sheep & Goats:All Stages Sign
Digestive Signs / Dysphagia, difficulty swallowing Sheep & Goats:All Stages Sign
Digestive Signs / Erythema, redness of pharynx Sheep & Goats:All Stages Sign
Digestive Signs / Excessive salivation, frothing at the mouth, ptyalism Sign
Digestive Signs / Oral mucosal ulcers, vesicles, plaques, pustules, erosions, tears Sheep & Goats:All Stages Diagnosis
Digestive Signs / Pharyngeal ulcers, vesicles, erosion, papules, sores pharynx Sheep & Goats:All Stages Diagnosis
Digestive Signs / Tongue ulcers, vesicles, erosions, sores, blisters, cuts, tears Sheep & Goats:All Stages Diagnosis
General Signs / Fever, pyrexia, hyperthermia Sheep & Goats:All Stages Sign
General Signs / Forelimb lameness, stiffness, limping fore leg Sign
General Signs / Generalized lameness or stiffness, limping Sign
General Signs / Generalized weakness, paresis, paralysis Sign
General Signs / Haemorrhage of any body part or clotting failure, bleeding Sign
General Signs / Head, face, ears, jaw, nose, nasal, swelling, mass Sign
General Signs / Hindlimb lameness, stiffness, limping hind leg Sign
General Signs / Lymphadenopathy, swelling, mass or enlarged lymph nodes Sheep & Goats:All Stages Sign
General Signs / Petechiae or ecchymoses, bruises, ecchymosis Sign
General Signs / Reluctant to move, refusal to move Sheep & Goats:All Stages Sign
General Signs / Swelling skin or subcutaneous, mass, lump, nodule Sheep & Goats:All Stages Diagnosis
General Signs / Weight loss Sheep & Goats:All Stages Sign
Nervous Signs / Dullness, depression, lethargy, depressed, lethargic, listless Sheep & Goats:All Stages Sign
Ophthalmology Signs / Chemosis, conjunctival, scleral edema, swelling Sign
Ophthalmology Signs / Conjunctival, scleral, injection, abnormal vasculature Sign
Ophthalmology Signs / Conjunctival, scleral, redness Sheep & Goats:Hogget,Sheep & Goats:Mature female,Sheep & Goats:Breeding male Sign
Ophthalmology Signs / Corneal edema, opacity Sheep & Goats:Hogget,Sheep & Goats:Mature female,Sheep & Goats:Breeding male Sign
Ophthalmology Signs / Lacrimation, tearing, serous ocular discharge, watery eyes Sheep & Goats:Lamb Sign
Ophthalmology Signs / Purulent discharge from eye Sign
Pain / Discomfort Signs / Skin pain Sheep & Goats:All Stages Sign
Reproductive Signs / Abortion or weak newborns, stillbirth Sheep & Goats:Gimmer,Sheep & Goats:Mature female Sign
Reproductive Signs / Agalactia, decreased, absent milk production Sign
Reproductive Signs / Mastitis, abnormal milk Sheep & Goats:Mature female Sign
Reproductive Signs / Mucous discharge, vulvar, vaginal Sheep & Goats:All Stages Sign
Reproductive Signs / Necrosis, vagina, vulva Sheep & Goats:All Stages Sign
Reproductive Signs / Papule, pustule, vesicle, ulcer penis or prepuce Sheep & Goats:Hogget,Sheep & Goats:Breeding male Diagnosis
Reproductive Signs / Purulent discharge, penis or prepuce Sheep & Goats:All Stages Sign
Reproductive Signs / Vaginal or cervical ulcers, vesicles, erosions, tears, papules, pustules Sheep & Goats:All Stages Sign
Reproductive Signs / Vulval ulcers, vesicles, erosions, tears, cuts, pustules, papules Sheep & Goats:Gimmer,Sheep & Goats:Mature female Diagnosis
Respiratory Signs / Abnormal breathing sounds of the upper airway, airflow obstruction, stertor, snoring Sign
Respiratory Signs / Abnormal lung or pleural sounds, rales, crackles, wheezes, friction rubs Sheep & Goats:All Stages Sign
Respiratory Signs / Coughing, coughs Sign
Respiratory Signs / Dyspnea, difficult, open mouth breathing, grunt, gasping Sheep & Goats:All Stages Sign
Respiratory Signs / Enlarged lung on percussion of chest, thorax Sheep & Goats:All Stages Sign
Respiratory Signs / Mucoid nasal discharge, serous, watery Sheep & Goats:All Stages Sign
Respiratory Signs / Nasal mucosal ulcers, vesicles, erosions, cuts, tears, papules, pustules Sheep & Goats:All Stages Diagnosis
Respiratory Signs / Purulent nasal discharge Sheep & Goats:All Stages Sign
Skin / Integumentary Signs / Hyperkeratosis, thick skin Sign
Skin / Integumentary Signs / Matted or dirty hair Sign
Skin / Integumentary Signs / Rough hair coat, dull, standing on end Sheep & Goats:All Stages Sign
Skin / Integumentary Signs / Scarred skin Sign
Skin / Integumentary Signs / Skin crusts, scabs Sheep & Goats:All Stages Diagnosis
Skin / Integumentary Signs / Skin edema Sheep & Goats:All Stages Sign
Skin / Integumentary Signs / Skin erythema, inflammation, redness Sheep & Goats:All Stages Sign
Skin / Integumentary Signs / Skin necrosis, sloughing, gangrene Sheep & Goats:All Stages Sign
Skin / Integumentary Signs / Skin papules Sheep & Goats:All Stages Diagnosis
Skin / Integumentary Signs / Skin plaque Sheep & Goats:All Stages Diagnosis
Skin / Integumentary Signs / Skin pustules Sheep & Goats:All Stages Diagnosis
Skin / Integumentary Signs / Skin ulcer, erosion, excoriation Sheep & Goats:All Stages Diagnosis
Skin / Integumentary Signs / Skin vesicles, bullae, blisters Sheep & Goats:All Stages Diagnosis

Disease Course

Top of page

There is considerable variation in the pathogenicity of strains of SGPX virus. Infection may be subclinical, cause a mild apparent disease, or cause severe, generalized SGPX. The introduction of virus may be through the oral, nasal or respiratory epithelium or via the skin dermis or epidermis. Local viral replication will occur in these affected epithelial tissues. Infected macrophage type cells are thought to transport the virus to the regional lymph nodes, where further viral replication takes place. There is a marked proliferative response in the affected lymph nodes, which greatly increase in size (Borrel, 1903a).

A strictly cell-associated viraemia then occurs, which introduces infected cells (probably macrophages) throughout the body. The virus then replicates further in the epithelial tissues of the skin, lungs, endothelium, muscle and, more rarely, in nervous tissue. The basic lesions in the various affected tissues are due to a vasculitis, thrombosis and the resulting necrosis. The balloon degeneration of epithelial cells, resulting in the vesicular-type lesions of small pox, may be found with sheep pox but are more rarely seen than the necrotic, scabbed epithelium and dermis, with full skin thickness lesions often leaving deep scarring of the hide (Plowright et al., 1959; Murray et al., 1973; Singh et al., 1979).

The incubation period for SGPX is 3-12 days following contact with infection. A fever of between 40 and 41°C, which may not be detected, then occurs. Lymphadenopathy may be noticed at this stage and the skin lesions appear after a further 24-48 h. The course of the disease is then acute for 5-15 days, during which time the fever persists and the skin lesions remain for 4-12 weeks. Pneumonia is also common. Various degrees of debility and emaciation develop, depending on the extent and severity of the lesions. Healing of the skin lesions is complete after 2-3 months (Singh et al., 1979; Davies, 1981).

The initial clinical signs are of fever, depression, a disinclination to move, often lachrymitis and conjunctivitis, and rhinitis with serous nasal discharge. Disease may appear more rapidly in goats than in sheep. Some enlargement of the superficial lymph nodes may be detected at this stage. After a further 24 to 48 h, local erythematous skin papules, irregularly round, of 3–25 mm in diameter may erupt, particularly on the hairless areas of the body such as the perineum, scrotum, axilla and groin, prepuce, mammary glands, muzzle and ears. The red areas are slightly raised above the areas of surrounding normal skin often with some serum exudation at the surface or oedema. These may swell to form small papules with vesicular fluid or become hard and necrotic with scab formation at the surface within 6-12 days. Often the whole lesion becomes hard and indurated and gradually separates from the surrounding areas of normal unaffected skin over 4-8 weeks.

The presence of skin lesions over the whole of the body greatly restricts the movement of the affected animal. Lesions in the oropharynx affect the ability to feed, drink and move. The papules on the mucous membranes quickly ulcerate, and the secretions of rhinitis and conjunctivitis become mucopurulent. Upper respiratory and pneumonic lesions may cause stertorious respiration and respiratory distress. Affected limbs, the prepuce and muzzle may become severely swollen and oedematous affecting movement and feeding, particularly in lambs. Lesions on the udder and teats greatly interfere with suckling and even cause mastitis. The debility results in agalactia. The disease is accompanied by emaciation, and the inability to feed may result in mortality from associated causes. The respiratory lesions are often accompanied by a secondary pneumonia, which may be fatal. A hyperacute syndrome may occur in lambs and kids, with generalized lesions and death within 2-4 days of onset.

Epidemiology

Top of page

Close contact with infected or recovered animals is probably the most important mechanism for the transmission of SGPX. High titres of virus are present in the pustular exudates from lesions and in epithelial tissue and scab debris. Inhalation of infected droplets or aerosols from infected animals has been shown to cause infection (Kitching and Taylor, 1985). Direct contact with infected sheep is the main means of infection, although the time taken for infection to become manifest in newly introduced sheep is surprisingly long, 20-40 days. Infection of abrasions at shearing or other times with infected debris from scabs and lesions may also occur. The virus can be transmitted by scarification, by intradermal, subcutaneous, intranasal and intravenous inoculation. Mixing of sheep at markets and at watering holes is a common cause of spread of infection. Indirect transmission may follow contact with infected premises such as pens or yards, the use of lorries, boats and shearing clippers, which have also been used by infected sheep or goats. Once a flock is infected, the disease will spread through all the animals within 6 to 12 weeks. The virus is very resistant and remains viable for long periods, on or off the animal host. They may persist for up to 6 months in shaded animal pens, and for at least 3 months in dry scabs on the fleece, skin and hair from infected animals. There is no evidence of animals in a carrier state that are persistently infected with goat and sheep poxvirus.

Animals are most infectious soon after the appearance of papules, during the 10 days before the development of significant levels of protective antibody. High titres of virus are present in papules, and those on the mucous membranes quickly ulcerate and release virus in nasal, oral and lachrymal secretions, and into milk, urine and semen, which all constitute important sources of virus dissemination. Transmission of the disease frequently occurs by aerosols during direct or intimate contact between infected and susceptible animals. Aerosol transmission may also occur from infected pustules and skin debris, although direct contact of virus with skin abrasions on the mouth or elsewhere is thought to play the major role. Animals that develop generalized lesions produce considerable quantities of virus and are highly infectious. Transmission by fomites is probably not of major importance (Kitching and Taylor, 1985a). Experimentally, the disease can also be transmitted by intradermal, intravenous and subcutaneous inoculation as well as by artificially produced virus aerosols. The virus may be transmitted by Stomoxys (Kitching and Mellor, 1986). But the outbreaks are not exclusively confined to the fly biting seasons where these are short-lived and distinct. Other transmission mechanisms are much more important.

There is no evidence, which suggests that intermediate hosts play any role in the epidemiology of sheep and goat pox. The virus has not been detected in wild ungulate populations. Poxviruses are resistant viruses capable of "long interval" transmission cycles and do not depend upon continuing direct animal to animal transmission (Matumoto, 1969). The presence of a resistant virus on the infected/recovered hosts and in the environment, particularly in stables and sheep sheds, ensures virus persistence.

The distribution of disease in enzootic areas frequently follows the distribution of traditional forms of husbandry (Kitching, 1994). The critical number of animals required to maintain goat poxvirus within a single population is not known. Disease in a village is usually only seen following the introduction of new animals, typically from market, and generally affects animals of all ages. The disease spreads through the village, usually within 3-6 months, and then disappears in the absence of more susceptible animals. Animals exported from countries that are free of sheep and goat poxvirus may be affected by sheep and goat pox when they arrive in enzootic areas. The severity of outbreak depends on the size of the susceptible population, the virulence of the strain of virus and the breed affected. Generally, an epidemic in a susceptible flock can affect over 75% of goats, with mortality as high as 50%, case fatality rates in young stock may approach 100%.

Impact: Economic

Top of page

Sheep and goat pox is the most important contagious disease of small ruminants throughout the regions where their populations are greatest. Many countries have achieved a considerable measure of control by restricting or regulating the movement of animals, with or without annual vaccination programmes. Such programmes can result in the eradication of the disease within 5 to 7 years. This has been achieved in many countries during the past 100 years. A traditional trade in small ruminants prevails throughout many regions where the disease is endemic. Successful implementation of such programmes is hindered in these areas by poor roads and inadequate institutional services. It is, however, feasible that coordinated regional programmes could achieve eradication.

The impact of the disease is dramatic in totally naïve populations. Mortality may be up to 70-90%, where lambs and kids are affected. In older age groups the mortality may be between 10 and 45%. This is influenced by many factors, such as severe weather conditions, the age structure and nutritional status of the flock and the existence of inter-current debilitating parasitic diseases such as haemonchosis or liver fluke. The hide damage, which follows recovery, may result in full skin thickness holes over much of the tanned skin rendering it useless for marketing. This is an important consequential loss following SGPX outbreaks.

The restriction of movement following the identification of SGPX may cause economic loss and the maintenance of a high level of herd immunity by vaccination, which is the only control option available in many countries for reasons discussed above, is a constant recurring cost item. The delivery of vaccine each year to a flock may cost US$ 0.25 to US$ 2 per dose, depending on transport and other costs. The vaccine itself can be produced fairly cheaply in tissue culture systems and the product is freeze dried and quite stable.

Zoonoses and Food Safety

Top of page

Human infections during the handling of infected animals are rare, except for the development of a mild localized reaction limited to the skin, with only 2 isolated cases reported to date (Bakos and Brag, 1957; Sawhney et al., 1972).

Fevered carcasses and those with lesions of SGPX will be detected and rejected at meat inspection. Infected carcasses pose no risk to human health although being aesthetically unacceptable.

The virus can persist for several months in carcasses held at 4°C and 20°C and constitutes a potential source of infection to the disease hosts if exported to a disease-free country. Contagion from discarded, uncooked meat offal constitutes a theoretical risk to any country free from the disease. Such material could contaminate pastures grazed by susceptible ruminant populations. The same applies to untreated hides and skins. The virus could persist on these for some months, protected by proteinaceous scab material. Cleaning hides and skins by washing could produce infective wastes, to which animals might be exposed.

Disease Treatment

Top of page

There are no specific treatments available for SGPX. Symptomatic treatments, such as anti-inflammatory painkillers or antibiotics to control secondary bacterial infections may be administrated. Water and food should be made easily available for infected and recovering animals.

Prevention and Control

Top of page

SGPX is a List A disease in the OIE classification and outbreaks are notifiable in OIE member countries.


Immunization and vaccines


SGPX immunization has been practised since the early attempts by Borrel (1903b). A generation of killed adjuvanted vaccines (Koyali et al., 1933; Uppal et al., 1967; Singh et al., 1979) has been succeeded by a generation of many modified live virus vaccine strains, which have been developed in many parts of the world (Ramyar and Hessami, 1967; Davies and Mbugwa 1985; Davies, 2002 in press). They have been derived from local pathogenic strains by passage in cell culture or embryos. Most have been effective although some strains have unacceptably high levels of residual pathogenicity and may cause local lesions and even abortion. For example, in different countries and sometimes within a country, various live, attenuated vaccines have been produced to prevent goat pox and these have had varying degrees of efficacy (Ramyar et al., 1974; Dubey and Sawhney, 1978; El-Zein et al., 1983; Davies and Mbugwa, 1985; Guo et al., 1986; Wang and Jiang, 1988a; Mahmood et al., 1989, 1993). The efficacy of such vaccines was judged upon the appearance of a local reaction at the site of inoculation, and this was taken as an indication of relative efficacy. There are vaccines available today, which produce no local reactions and which are highly immunogenic with a PD 50 of less than 5 TCID 50. Most live SGPX vaccines produce the lifelong immunity. In enzootic areas, both live attenuated and inactivated vaccines are useful in the prevention and control of goat pox, but inactivated vaccines give only short-term immunity (Prasad and Datt, 1973; Yadav et al., 1986; Pal and Soman, 1992). Heterologous vaccines generally work well.

A subunit vaccine also appears to be of some use in the control of disease as revealed by higher neutralization indices in immunized goats (Carn et al., 1994b). Moreover, a single vaccine prepared from a strain of capripoxvirus that infects sheep and goats equally is effective in controlling both goat pox and sheep pox for at least 12 months (Kitching et al., 1987b; Carn, 1993). Nevertheless, reports of cross-protection of sheep and goats against goat pox and sheep pox and other related diseases such as contagious ecthyma are often contradictory and inconclusive (Ergin et al., 1988; Wang and Jiang, 1988b); attempts to protect either goats with sheep capripoxvirus vaccines or sheep with goat capripoxvirus vaccines are largely unsuccessful (Prasad and Datt, 1973; Agrawal and Soman, 1997).


Husbandry methods and good practice


Vaccination is recommended for animals of all ages and thereafter lambs and kids should be vaccinated annually, at 12-16 weeks of age, when the maternal antibody has disappeared. Where enclosed farming systems exist, the use of vaccine for several years will eliminate the disease completely, as long as vaccination is maintained on an annual basis for all young stock and great care is taken to introduce only vaccinated stock from clean areas. Individual farms can maintain complete freedom from disease in this way and coordinated national programmes can have a dramatic effect upon the disease. Coordinated control of movements from uninfected foci and complete restriction of movements from the infected areas will maintain the disease-free situation. Ring vaccination is frequently practiced during outbreaks in enzootic areas, but usually only the species that are clinically affected are vaccinated.

If national vaccination programmes are established with strict quarantine and movement controls, and if disease foci are identified, they will have a dramatic effect upon SGPX in 3-5 years. A stage will be reached where a stamping out policy can be adopted for any new foci of disease. Absolute integrity and enforcement of movement controls is critical when the infected foci have been identified. If this can be achieved, SGPX eradication programmes can be successful in quite a short time frame.

The following points are extremely useful for sanitary prophylaxis.

  • Isolation of infected herds and sick animals for at least 45 days after recovery
  • Slaughtering of infected herd (as far as possible)
  • Proper disposal of cadavers and products
  • Stringent disinfection
  • Quarantine before introduction into herds
  • Animal and vehicle movement controls within infected areas

Local control


In the semi-arid zones of Africa, Eastern Europe and Asia, where SGPX is endemic, the problems of control of the disease are great: the range is not enclosed, there is movement of animals in search of water and grazing, and mixing of different population groups is inevitable in these extensive husbandry systems. Trade is also continuous, extensive and largely beyond any institutional control, with little regards for national boundaries. In these situations the control of SGPX is difficult and demanding. Individual animal owners practise vaccination and national schemes may achieve extensive vaccination cover over very large areas. Drought, civil unrest or other similar events, can totally destroy all the progress, which has been made, however, and large regionally coordinated schemes may be required to have any lasting impact.

In endemic areas, a regular cleaning programme for winter housing is essential to eliminate any residual virus that may remain dormant. Poxviruses are capable of long intervals between animal to animal transmission. Owners often report the appearance of cases when they house the animals for the winter period. Virus may persist for several months in organic matter and this is even more essential, if there have been cases of disease. Thorough cleaning and removal of the dung and subsequent treatment with phenol, alkali or other suitable disinfectants is advisable to eliminate any residual virus. Detergents will kill the virus by dissolving the outer lipid membrane.

Capripox-free countries maintain their disease-free status by the restriction of imports of livestock and animal products from affected areas. In the case of countries remote from enzootic areas, the swift implementation of a radical slaughter policy and severe movement restrictions, coupled with a ring vaccination of radius 25-50 km should result in elimination of disease (Carn, 1993).


Clinical management


All infected sheep and goats should be placed in a clean, well-ventilated house and fed on a good and balanced diet. Animals reluctant to feed should be given 10% glucose saline parenterally. All diseased animals should be given antibiotic coverage to restrict secondary bacterial infections. To relieve respiratory-related signs, nostrils should be cleaned and washed with a weak solution of potassium permanganate (1:10,000). Respiration should be stimulated with oleum eucalyptus inhalations or coramine. Antibiotic ointment or powder should be applied topically to skin lesions (Nandi et al., 1999).

References

Top of page

Abdussalam M, 1957. Elementary bodies of sheep pox. American Journal of Veterinary Research, 18:614-617.

Abo-Shehada MN, 1990. Vaccine-induced goatpox in an imported Saanen goat flock in Jordan. Preventive Veterinary Medicine, 9(2):159-161; 6 ref.

African Union-Interafrican Bureau for Animal Resources, 2011. Panafrican Animal Health Yearbook 2011. Pan African Animal Health Yearbook, 2011:xiii + 90 pp. http://www.au-ibar.org/index.php?option=com_flexicontent&view=items&cid=71&id=109&Itemid=56&lang=en

Agrawal SK, Soman JP, 1997. Assessment of immune efficacy of attenuated live goat pox vaccine against sheep pox and contagious ecthyma. Indian Veterinary Journal, 74(12):1016-1018; 9 ref.

Agriculture Western Australia, 1999. Agriculture Protection: Managing the risk of sheep and goat pox. Australia: Agriculture Western Australia Publications. Northam Agricultural Memo, 25(8).

Anil-Sachan et al, 2000. Sheep pox virus infection alters T lymphocyte subpopulation in sheep. International Journal of Animal Sciences, 15(1):105-108.

Anthony RL, Daniel RW, Cole JL, Heiner GG, McCrumb FR Jr, 1971. Variola virus and immunity in small pox. II. Recovery of variola specific soluble antigens from infected rhesus monkey kidney cells. Journal of Infectious Diseases, 123:399-405.

Babiuk S, Parkyn G, Copps J, Larence JE, Sabara MI, Bowden TR, Boyle DB, Kitching RP, 2007. Evaluation of an ovine testis cell line (OA3.ts) for propagation of capripoxvirus isolates and development of an immunostaining technique for viral plaque visualization. Journal of Veterinary Diagnostic Investigation, 19(5):486-491.

Babiuk S, Wallace DB, Smith SJ, Bowden TR, Dalman B, Parkyn G, Copps J, Boyle DB, 2009. Detection of antibodies against capripoxviruses using an inactivated sheeppox virus ELISA. Transboundary and Emerging Diseases, 56(4):132-141. http://www3.interscience.wiley.com/cgi-bin/fulltext/122246939/HTMLSTART

Bachh AS, Ram GC, Hopkins J, Bansal MP, 1997. Observations on cellular response in experimentally sheep-pox-infected lambs. Indian Journal of Animal Sciences, 67(4):263-266; 21 ref.

Bakos K, Brag S, 1957. Studies of goat pox in Sweden. Nord. VetMed., 9:431-439.

Balinsky CA, Delhon G, Smoliga G, Prarat M, French RA, Geary SJ, Rock DL, Rodriguez LL, 2008. Rapid preclinical detection of sheeppox virus by a real-time PCR assay. Journal of Clinical Microbiology, 46(2):438-442. http://jcm.asm.org/

Bandyopadhyay SK, Gajendragad MR, Dhal NK, Gupta AR, Yadav MP, 1984. Some observations on a goat pox virus isolated from an outbreak in Orissa. The Indian Journal of Animal Sciences, 54:961-964.

Batta MK, Katoch RC, Mandeep Sharma, Joshi VB, Nagal KB, 1999. Epidemiological observation on goat pox in Himachal Pradesh. Indian Veterinary Journal, 76(8):683-684; 6 ref.

Bennet SCJ, Horgon ES, Munsur MA, 1944. The pox diseases of sheep and goats. The Journal of Comparative Pathology and Therapeutics, 54:131-160.

Bhambani BD, Krishnamurthy D, 1963. An immunodiffusion test for the diagnosis of sheep and goat pox. The Journal of Comparative Pathology and Therapeutics, 73:349-357.

Bhat PP, 1993. Molecular characterization of pox (viral) DNA. Indian Journal of Animal Sciences, 63(8):857-862; 21 ref.

Bhowmik MK, Ghosh RK, Bhattacharyya B, Chakraborty AK, 1986. Goat pox in West Bengal. Indian Journal of Animal Health, 25(1):15-18; 17 ref.

Bidjeh K, Ganda K, Diguimbaye C, Idriss A, 1990. Note on goat pox in Chad: study of outbreaks. Revue d'élevage et de Médecine Vétérinaire des Pays Tropicaux, 43(1):31-33; 7 ref.

Black DN, Hammond JM, Kitching RP, 1986. Genomic relationship between capripoxviruses. Virus Research, 5(2/3):277-292; 22 ref.

Blanc G, Melanidi C, Stylianopoulo M, 1929. Variola of goats in Greece. Arch. Inst. Pasteur Hellenique, 2(1):129-133.

Borrel A, 1903. Etude experimentale de la clavelee. Annales de l'Institute Pasteur, 17:123-127.

Borrel A, 1903. Etudes sur la clavelee. Serotherapie et seroclavelisation. Annales de l'Institut Pasteur, 17:732-762.

Bowden TR, Babiuk SL, Parkyn GR, Copps JS, Boyle DB, 2008. Capripoxvirus tissue tropism and shedding: a quantitative study in experimentally infected sheep and goats. Virology, 371(2):380-393. http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6WXR-4R2Y445-3&_user=6686535&_coverDate=02%2F20%2F2008&_rdoc=17&_fmt=full&_orig=browse&_srch=doc-info(%23toc%237165%232008%23996289997%23679310%23FLA%23display%23Volume)&_cdi=7165&_sort=d&_docanchor=&_ct=22&_acct=C000066028&_version=1&_urlVersion=0&_userid=6686535&md5=cd49df363c04f3ecb7a19f20868f4fd4

Bowden TR, Coupar BE, Babiuk SL, White JR, Boyd V, Duch CJ, Shiell BJ, Ueda N, Parkyn GR, Copps JS, Boyle DB, 2009. Detection of antibodies specific for sheeppox and goatpox viruses using recombinant capripoxvirus antigens in an indirect enzyme-linked immunosorbent assay. Journal of Virological Methods, 161(1):19-29. http://www.sciencedirect.com/science/journal/01660934

Capstick PB, Coakley W, 1962. Lumpy Skin disease. The determination of the immune status of cattle by an intra-dermal test. Res. Vet. Sci., 3:287-291.

Carn VM, 1993. Control of capripoxvirus infections. Vaccine, 11(13):1275-1279; 56 ref.

Carn VM, 1995. An antigen trapping ELISA for the detection of capripoxvirus in tissue culture supernatant and biopsy samples. Journal of Virological Methods, 51:95-102.

Carn VM, Kitching RP, Hammond JM, Chand P, Anderson J, Black DN, 1994. Use of a recombinant antigen in an indirect ELISA for detecting bovine antibody to capripoxvirus. Journal of Virological Methods, 49(3):285-294; 30 ref.

Carn VM, Timms CP, Chand P, Black DN, Kitching RP, 1994. Protection of goats against capripox using a subunit vaccine. Veterinary Record, 135(18):434-436; 5 ref.

Cho CT, Wenner HA, 1973. Monkeypox virus. Bacteriological Reviews, 37:1-18.

Dales S, Pogo BGT, 1981. Biology of poxviruses. Virology Monographs, 18:1-109.

Das SK, Mallick BB, Garg A, 1986. Cell-mediated immune response with modified strain of sheep-pox virus. Indian Journal of Animal Sciences, 56(3):297-300; 10 ref.

Das SK, Pandey AK, Mallick BB, 1978. A note on the natural goat pox outbreak in Garwal Hills of Uttar Pradesh. The Indian Veterinary Journal, 55:671-673.

Datta S, Soman JP, 1991. Host range and physico-chemical characterization of 'Ranchi' strain of goat-pox virus. Indian Journal of Animal Sciences, 61(9):955-957; 11 ref.

Davies FG, 1976. Characteristics of a virus causing a pox disease in sheep and goats in Kenya, with observations on the epidemilogy and control. Journal of Hygiene, Cambridge, 76:163-171.

Davies FG, 1981. Sheep and Goat Pox. In: Gibbs EPJ, ed. Virus Diseases of Food Animals. London, UK: Academic Press, 733-749.

Davies FG, 1991. Lumpy skin disease, an African capripox virus disease of cattle. British Veterinary Journal, 147(6):489-503; 40 ref.

Davies FG, Mbugwa G, 1985. The alterations in pathogenicity and immunogenicity of a Kenya sheep and goat pox virus on serial passage in bovine foetal muscle cell cultures. Journal of Comparative Pathology, 95(4):565-572; 11 ref.

Davies FG, Otema C, 1978. The antibody response in sheep infected with sheep and goat pox virus. Journal of Comparative Pathology, 88:205-210.

Davies FG, Otema C, 1981. Relationships of some Capripox viruses found in Kenya with two Middle eastern strains and some Orthopox viruses. Research in Veterinary Science, 31:253-255.

Deshmukh VV, Gujar MB, 1992. Study of cell mediated immune response in kids vaccinated and infected against goat-pox virus. Livestock Adviser, 17(9):7-10; 4 ref.

Dubey SC, Sawhney AM, 1978. Live and inactivated tissue culture vaccines against goat pox. The Indian Veterinary Journal, 55:926-927.

El-Zein A, Nehme S, Singh KV, 1983. Preparation and testing of a goat pox vaccine from a pathogenic field isolate attenuated in cell culture. Zentralblatt fur Veterinarmedizin, 30:341-348.

Ergin H, Köklü A, Onar B, 1988. Preparation of a goat pox vaccine in lambs kidney cell cultures and immunity tests in goats. Pendik Hayvan Hastaliklari Merkez Avastirma Enstitüsü Dergisi, 19(1-2):60-65; 10 ref.

Fernandez P, 1991. Foreign animal disease update. Foreign Animal Disease Report, 19(1):3-7.

Gershon PD, Black DN, 1988. A comparison of the genomes of capripoxvirus isolates of sheep, goats, and cattle. Virology, 164(2):341-349; 23 ref.

Gulbahar MY, Cabalar M, Gul Y, Icen H, 2000. Immunohistochemical detection of antigen in lamb tissues naturally infected with sheep pox virus. Journal of Veterinary Medicine, Series-B, 47(3):173-181.

Guo H, Guo ZY, Sheng ZP, Liu QG, 1986. Goat pox cell culture attenuated vaccine. Chinese Journal of Veterinary Science and Technology, No.3:8-10.

Hajer I, Abbas B, Samra MTA, 1988. Capripox virus in sheep and goats in Sudan. Revue d'élevage et de Médecine Vétérinaire des Pays Tropicaux, 41(2):125-128; 11 ref.

Heine HG, Stevens MP, Foord AJ, Boyle DB, 1999. A capripoxvirus detection PCR and antibody ELISA based on the major antigen P32, the homolog of the vaccinia virus H3L gene. Journal of Immunological Methods, 227(1/2):187-196; 19 ref.

House JA, 1992. Sheep and goat pox. Veterinary diagnostic virology: a practitioners guide., 217-219; 3 ref.

Hussein M, El-Sadi HI, Zangana IK, El-Attar MY, Al-Bana AS, 1989. Clinical, pathological and virological studies on goat pox in Mosul, Iraq. Veterinary Medical Journal Giza, 37(1):65-76; 17 ref.

Hutyra F, Marek J, Manninger R, 1949. Special pathology and therapeutics of the diseases of domestic animals. London, UK: Bailliere, Tindall and Cox.

Ireland DC, Binepal YS, 1998. Improved detection of capripoxvirus in biopsy samples by PCR. Journal of Virological Methods, 74(1):1-7; 20 ref.

Isloor S, Negi BS, 1995. Characterization of soluble antigens of goat pox virus. The Indian Journal of Animal Sciences, 65:240-245.

Isloor S, Negi BS, Somvanshi R, 1991. Pulmonary lesions in goat pox. Indian Journal of Veterinary Pathology, 15(2):106-108; 11 ref.

Joshi RK, Ali SL, Sanjay Shakya, Rao VN, 1999. Clinico-epidemiological studies on a natural outbreak of goat pox in Madhya Pradesh. Indian Veterinary Journal, 76(4):279-281; 8 ref.

Joshi RK, Chandra R, Rao VDP, Garg SK, 1989. Coagglutination test: a simple and rapid diagnostic technique for goat pox. Tropical Animal Health and Production, 21(4):233-235; 6 ref.

Karim MA, 1983. Pox among Sannen goats in Iraq. Tropical Animal Health and Production, 15:62.

Kavishe TS, 1988. Country report on animal health. Tanzania. Animal health problems in selected African countries. Report of a technical consultation in Lusaka, Zambia, 23-28 November 1987., 85-97; [Arbetsrapport 91].

Kilelu ES, 1991. Prevalence of sheep and goat pox in Kenya. Bulletin of Animal Health and Production in Africa, 39(4):451-452; 3 ref.

Kitching PR, Mellor PS, 1986. Insect transmission of Capripox viruses. Res. Vet. Sci., 40:255-258.

Kitching RP, 1983. Progress towards sheep and goat pox vaccines. Vaccine, 1:4-9.

Kitching RP, 1986. Passive protection of sheep against capripoxvirus. Research in Veterinary Science, 41(2):247-250; 9 ref.

Kitching RP, 1986. The control of sheep and goat pox. Revue Scientifique et Technique, Office International des Épizooties, 5(2):503-511. http://www.oie.int/doc/ged/D8594.PDF

Kitching RP, 1994. Sheep and goat poxviruses. In: Webster RG, Granoff A, eds. Encyclopedia of Virology. London: Academic Press, 1160-1165.

Kitching RP, Hammond JM, Black DN, 1986. Studies on the major common precipitating antigen of capripoxvirus. Journal of General Virology, 67(1):139-148; 20 ref.

Kitching RP, Hammond JM, Taylor WP, 1987. A single vaccine for the control of capripox infection in sheep and goats. Research in Veterinary Science, 42(1):53-60; 15 ref.

Kitching RP, McGrane JJ, Hammond JM, Miah AH, Mustafa AHM, Majumder JR, 1987. Capripox in Bangladesh. Tropical Animal Health and Production, 19(4):203-208; 9 ref.

Kitching RP, McGrane JJ, Taylor WP, 1986. Capripox in the Yemen Arab Republic and the Sultanate of Oman. Tropical Animal Health and Production, 18(2):115-122; 4 ref.

Kitching RP, Mellor PS, 1986. Insect transmission of capripoxvirus. Research in Veterinary Science, 40(2):255-258; 12 ref.

Kitching RP, Smale C, 1986. Comparison of the external dimensions of capripoxvirus isolates. Research in Veterinary Science, 41(3):425-427; 15 ref.

Kitching RP, Taylor WP, 1985. Clinical and antigenic relationship between isolates of sheep and goat pox viruses. Tropical Animal Health and Production, 17(2):64-74; 11 ref.

Kitching RP, Taylor WP, 1985. Transmission of capripoxvirus. Research in Veterinary Science, 39(2):196-199; 12 ref.

Koyali AC, Mavridis N, Il Hami, 1933. Etude sur le virus de la variole des chevres. Vaccination du mouton et la chevre. Recueil Medecin Veterinaire, 109:920-932.

Kuppuswamy AR, 1936. Caprine variola in province Wallesley varus (A blotch on the face). The Indian Veterinary Journal, 13:130-138.

Lamien CE, Lelenta M, Goger W, Silber R, Tuppurainen E, Matijevic M, Luckins AG, Diallo A, 2011. Real time PCR method for simultaneous detection, quantitation and differentiation of capripoxviruses. Journal of Virological Methods, 171(1):134-140. http://www.sciencedirect.com/science/journal/01660934

Lancelot R, Imadine M, Mopaté Y, Faye B, 1994. Improving goat productivity in the outskirts of N'Djaména (Chad). Choice of improvement measures following an ecopathological survey. Veterinary Research, 25(2/3):337-343; 7 ref.

Maeda MA, Kasonta JS, 1996. A study of the epidemiological factors and cross immunity of pox diseases in goat pox and orf in domestic ruminants in Tanzania. Proceedings held at Commission for Science and Technology Dar Es Salaam, Tanzania 4-5 July 1994, Stockholm, Sweden: International Foundation for Science (IFS), 32-36.

Mahmood MA, Afzaal S, Ahmad M, Hassni Z, Khan M, 1989. Preparation of live goat pox tissue culture vaccine. Pakistan Journal of Veterinary Research, 2(1-2):31-37; 7 ref.

Mahmood MA, Ahmad M, Afzaal S, Khan MS, 1993. Experimental immune response of Iranian goat pox vaccine virus strain against prevalent virus in Pakistan. Pakistan Veterinary Journal, 13(3):125-127; 7 ref.

Mangana-Vougiouka O, Markoulatos P, Koptopoulos G, Nomikou K, Bakandritsos N, Papadopoulos O, 1999. Sheep poxvirus identification by PCR in cell cultures. Journal of Virological Methods, 77(1):75-79; 10 ref.

Markoulatos P, Mangana-Vougiouka O, Koptopoulos G, Nomikou K, Papadopoulos O, 2000. Detection of sheep poxvirus in skin biopsy samples by a multiplex polymerase chain reaction. Journal of Virological Methods, 84(2):161-167; 11 ref.

Matthews REF, 1982. Classification and nomenclature of viruses. Intervirology, 17:1-199.

Matumoto M, 1969. Mechanisms for the perpetuation of animal viruses in nature. Bacteriological Reviews, 33:401-413.

Mohamed KA, Hago BED, Taylor WP, Nayil AA, Abu-Samra MT, 1982. Goat pox in the Sudan. Tropical Animal Health and Production, 14:104-108.

Murphy FA, Fauquet CM, Bishop DHL, Gharial SA, Jarvis AW, Martelli GP, Mayo MA, Summers MD, 1995. Virus Taxonomy: Classification and Nomenclature of Viruses. Sixth Report of the International Committee on Taxonomy of Viruses. New York, USA: Springer-Verlag/Wien.

Nagpal AK, Vihan VS, Singh D, Singh SV, Nem Singh, 1990. Epidemiological study of an outbreak of goat-pox and its effect on the performance of kids. Indian Journal of Animal Sciences, 60(5):544-546; 5 ref.

Nandi S, Rao TVS, 1997. Goatpox - a major threat to the goat industry in India. Indian Farming, 47(3):26-27.

Nandi S, Rao TVS, 2000. Development and application of PCR technique for the detection of capripox viral DNA. Proceedings of VII Convention and National Symposium. Guwahati, India: Indian Society for Veterinary Immunology and Biotechnology.

Nandi S, Rao TVS, Poonam Malik, 1999. Sheep pox - a scourge to the sheep industry in India. Indian Farming, 49(6):29-31.

Negi BS, Pandey AB, Yadav MP, Sharma B, 1988. Evaluation of allergic test in goat pox. Indian Journal of Virology, 4(1-2):26-33; 11 ref.

Ngichabe CK, Binepal YS, Njiru JW, Carn VM, 1999. Evaluation of an immunocapture enzyme-linked immunosorbent assay for detection of capripoxviruses. Veterinary Record, 145(8):231-232; 11 ref.

Nooruddin M, Hoque MH, Barik MA, Islam SMN, 1987. Prevalence of skin diseases in Black Bengal goats. Bangladesh Veterinarian, 4(1-2):5-9; 8 ref.

Office International des épizooties, 1997. World animal health in 1996. Part 1. Reports on the animal health status and disease control methods, and List A disease outbreaks - statistics. World animal health in 1996. Part 1. Reports on the animal health status and disease control methods, and List A disease outbreaks - statistics., 391 pp.

OIE Handistatus, 2002. World Animal Health Publication and Handistatus II (dataset for 2001). Paris, France: Office International des Epizooties.

OIE Handistatus, 2003. World Animal Health Publication and Handistatus II (dataset for 2002). Paris, France: Office International des Epizooties.

OIE Handistatus, 2004. World Animal Health Publication and Handistatus II (data set for 2003). Paris, France: Office International des Epizooties.

OIE Handistatus, 2005. World Animal Health Publication and Handistatus II (data set for 2004). Paris, France: Office International des Epizooties.

OIE, 1984. Bulletin Office International des Epizooties, Paris, France: World Organization for Animal Health.

OIE, 1985. Bulletin Office International des Epizooties, Paris, France: World Organization for Animal Health.

OIE, 1986. Bulletin Office International des Epizooties, Paris, France: World Organization for Animal Health.

OIE, 1989. Bulletin Office International des Epizooties, Paris, France: World Organization for Animal Health.

OIE, 1990. Bulletin Office International des Epizooties, Paris, France: World Organization for Animal Health.

OIE, 1991. Bulletin Office International des Epizooties, Paris, France: World Organization for Animal Health.

OIE, 1992. Bulletin Office International des Epizooties, Paris, France: World Organization for Animal Health.

OIE, 1993. Bulletin Office International des Epizooties, Paris, France: World Organization for Animal Health.

OIE, 1994. Bulletin Office International des Epizooties, Paris, France: World Organization for Animal Health.

OIE, 1995. Bulletin Office International des Epizooties, Paris, France: World Organization for Animal Health.

OIE, 1996. Bulletin Office International des Epizooties, Paris, France: World Organization for Animal Health.

OIE, 1997. Bulletin Office International des Epizooties, Paris, France: World Organization for Animal Health.

OIE, 1998. Bulletin Office International des Epizooties, Paris, France: World Organization for Animal Health.

OIE, 1999. Bulletin Office International des Epizooties, Paris, France: World Organization for Animal Health.

OIE, 2003. Sheep and goat pox in Saudi Arabia. Disease Information, 16, No. 51.

OIE, 2009. World Animal Health Information Database - Version: 1.4. World Animal Health Information Database. Paris, France: World Organisation for Animal Health. http://www.oie.int

OIE, 2012. World Animal Health Information Database. Version 2. World Animal Health Information Database. Paris, France: World Organisation for Animal Health. http://www.oie.int/wahis_2/public/wahid.php/Wahidhome/Home

Okaiyeto SO, Sackey AK, Lawal IA, Daggana D, Alam L, 1995. Outbreak of goatpox in Zaria, Kaduna State of Nigeria (case report). Israel Journal of Veterinary Medicine, 50(2):65-66; 5 ref.

Okoh AEJ, Obasaju MF, 1983. A disease simulating goat-specific pox in Kano, Nigeria. Tropical Animal Health and Production, 15(4):226; 3 ref.

Orlova ES, Shcherbakov AV, Diev VI, Zakharov VM, 2006. Differentiation of capripoxvirus species and strains by polymerase chain reaction. Molecular Biology (New York), 40(1):139-145. http://springerlink.metapress.com/link.asp?id=106292

Pal JK, Soman JP, 1992. Further trials on the inactivated goat pox vaccine. Indian Journal of Virology, 8(2):86-91; 20 ref.

Pandey AK, Malik BS, Bansal MP, 1969. Studies on sheep poxvirus. II. Immune and antibody response with cell culture adapted virus. The Indian Veterinary Journal, 46:1017-1023.

Pandey R, Singh IP, 1972. Soluble antigens of sheep pox and goat pox viruses as determined by immunodiffusion in agar gel. Acta Virologica, 16:41-46.

Plowright W, Macleod WG, Ferris RD, 1959. The pathogenesis of sheep pox in the skin of sheep. Journal of Comparative Pathology, 69:400-413.

Prasad IJ, Datt NS, 1973. Observation on the use of live and inactivated vaccines against goat pox. The Indian Veterinary Journal, 50:1-10.

Puranchand, Rao VDP, Chandra R, Garg SK, 1987. A note on the antigenic relationship of sheep pox virus strains. Indian Journal of Veterinary Medicine, 7:166-168.

Rafyi A, Ramyar H, 1959. Goat pox in Iran, serial passage in goats and the developing eggs and relationship with sheep pox. The Journal of Comparative Pathology and Therapeutics, 69:141-147.

Ramyar H, Hessami M, 1967. Development of a live attenuated virus vaccine against sheep pox. Zentralblatt fur Veterinarmedizin B, 14:516-519.

Ramyar H, Hessami M, Ghaboussi B, 1974. Goat pox: immunogenicity of vaccine virus modified in cell culture. Recueil de Medecine Veterinaire, 150(2):131-133.

Rao BM, Rao MVS, 1999. An indirect IgM enzyme linked immunosorbent assay for diagnosis of sheep pox virus infection. Indian Veterinary Journal, 76(12):1050-1054; 7 ref.

Rao PB, Madhubala K, Rao MR, 1998. Prevalence of viral and bacterial diseases among goats in Andhra Pradesh. Indian Veterinary Journal, 75(10):924-925; 2 ref.

Rao TVS, Bandyopadhyay SK, 2000. A comprehensive review of goat pox and sheep pox and their diagnosis. Animal Health Research Reviews, 1(2):127-136.

Rao TVS, Negi BS, 1997. Evaluation of different serological tests for the diagnosis of goat pox using soluble antigens. Tropical Animal Health and Production, 29(4):235-239; 15 ref.

Rao TVS, Negi BS, Bansal MP, 1996. Identification and characterization of differentiating soluble antigens of sheep and goat poxviruses. Acta Virologica, 40(5/6):259-262; 19 ref.

Rao TVS, Negi BS, Bansal MP, 1997. Development and standardization of a rapid diagnostic test for sheep pox. Indian Journal of Comparative Microbiology, Immunology and Infectious Diseases, 18(1):47-51; [11 ref].

Rao TVS, Negi BS, Bansal MP, 1997. Isolation and characterization of soluble antigens of sheep poxvirus. Indian Journal of Experimental Biology, 35(6):597-602; 30 ref.

Rao TVS, Negi BS, Bansal MP, 1997. Use of purified soluble antigens of sheep poxvirus in serodiagnosis. Indian Journal of Animal Sciences, 67(8):642-645; 21 ref.

Rao TVS, Negi BS, Dhar P, Asgola D, 1996. Evaluation of latex agglutination test for rapid detection of goat poxvirus antigen and antibodies. Acta Virologica, 40(2):95-97; 17 ref.

Rao TVS, Poonam Malik, Asgola D, 1999. Evaluation of avidin-biotin ELISA for the detection of antibodies to goat poxvirus using noninfectious diagnostic reagent. Acta Virologica, 43(5):297-301; 32 ref.

Rao TVS, Poonam Malik, Nandi S, Negi BS, 1997. Evaluation of immunocapture ELISA for diagnosis of goat pox. Acta Virologica, 41(6):345-348; 14 ref.

Renshaw HW, Dodd AG, 1978. Serologic and cross-immunity studies with contagious ecthyma and goat pox virus isolates from the Western United States. Archives of Virology, 56:201-210.

Saha GR, Nayak NC, Bhowmik MK, 1991. Studies on lymphoid lesions of goat pox. Indian Journal of Animal Research, 25(1):1-4; 10 ref.

Saha GR, Roy SS, Mukherjee N, Mitra K, 1985. Clinical and epidemiological features of pox in Black Bengal goats of West Bengal (India). Indian Journal of Animal Health, 24(1):29-34; [2 fig.]; 7 ref.

Sawhney AN, Singh AK, Malik BS, 1972. Goat-pox: An anthropozoonosis. The Indian Journal of Medical Research, 60:683-684.

Sedhukhan T, Nag NC, Ray JP, Nandi S, Das R, 1998. Application of dot-ELISA in the diagnosis of goat pox outbreak. Indian Veterinary Journal, 75(9):841-842; 6 ref.

Sharma B, Negi BS, Pandey AB, Bandyopadhyay SK, Shankar H, Yadav MP, 1988. Detection of goat pox antigen and antibody by the counter immunoelectrophoresis test. Tropical Animal Health and Production, 20(2):109-113; 8 ref.

Sharma B, Negi BS, Yadav MP, Shankar H, Pandey AB, 1988b. Application of ELISA in the detection of goat pox antigen and antibodies. Acta Virologica, 32:65-69.

Sharma SN, Dhanda MR, 1969. Serological studies on sheep and goat poxviruses. The Indian Journal of Animal Sciences, 40:522-528.

Sharma SN, Dhanda MR, 1971. Immunodiffusion studies with sheep and goat pox viruses. Indian Journal of Animal Science, 41:161-167.

Sharma SN, Dhanda MR, 1971. Studies on sheep- and goat-pox viruses. Relationship with contagious pustular dermatitis and vaccinia viruses. The Indian Journal of Animal Sciences, 41:864-867.

Sharma SN, Dhanda MR, 1972. Studies on sheep- and goat-pox viruses. Pathogenicity. Indian Journal of Animal Health, 11:39-46.

Singh IP, Pandey R, Srivastava RN, 1979. Sheep Pox, a review. Veterinary Bulletin, 49:145-154.

Singh RP, Tiwari AK, Negi BS, 1998. Evaluation of hyperimmune sera against goat pox viral antigens. Tropical Animal Health and Production, 30(4):229-232; 7 ref.

Slagsvold L, 1938. Goat pox and allied conditions in sheep and goats in Norway. Skand. VetTidskr., 28:471-495.

Soad MS, Wafaa AZ, Micheal A, Fayed AA, Taha MM, 1996. Studies on sheep and goat pox viruses from naturally infected animals. Assiut Veterinary Medical Journal, 35(70):29-38; 23 ref.

Soman JP, Sinha RP, Jha GJ, 1985. Occurrence of malignant goat pox in Bihar and confirmation of the causal virus. Indian Veterinary Journal, 62(10):907; 2 ref.

Subbarao MV, Malik BS, Sharma SN, 1984. Antigenic relationships among sheep pox, goat pox and CPD viruses. Acta Virologica, 28:380-387.

Tantawi HH, Al-Falluji MM, 1979. Laboratory characteristics of four strains of goatpox virus. Acta Virologica, 23:455-460.

Tantawi HH, Awad MM, Shony MO, Alwan AH, Hassan FK, 1980. Preliminary characterization of the 'Sersenk' strain of goat-pox virus. Journal of Tropical Animal Health and Production, 22:30-34.

Tian Hong, Chen Yan, Wu JinYan, Shang YouJun, Liu XiangTao, 2010. Serodiagnosis of sheeppox and goatpox using an indirect ELISA based on synthetic peptide targeting for the major antigen p32. Virology Journal, 7(245):(21 September 2010). http://www.virologyj.com/content/7/1/245

Tiwari AK, Nandi S, Negi BS, 1995. Reverse phase passive haemagglutination (RPHA) test for the detection of goat pox virus antigen. Indian Journal of Virology, 11(2):35-37; 8 ref.

Tiwari AK, Negi BS, 1994. Neutralising antibody response to goat pox virus soluble antigens. Indian Journal of Veterinary Research, 3(2):20-24; 8 ref.

Tiwari AK, Negi BS, 1996. Comparative efficacy of dot-ELISA and single radial haemolysis (SRH) test in detecting goat pox antigen. Indian Veterinary Journal, 73(10):1017-1020; 5 ref.

Tiwari AK, Negi BS, 1996. Single radial haemolysis for the detection of goat pox virus antigen and antibody. Tropical Animal Health and Production, 28(1):117-120; 8 ref.

Tiwari AK, Rao TVS, Negi BS, 1996. Spot agglutination test for the rapid diagnosis of goat pox. Tropical Animal Health and Production, 28(3):213-215; 6 ref.

Tuppurainen ESM, Venter EH, Coetzer JAW, 2005. The detection of lumpy skin disease virus in samples of experimentally infected cattle using different diagnostic techniques. Onderstepoort Journal of Veterinary Research, 72(2):153-164.

Uppal PK, Nilakantan PP, Sakkubai PR, 1967. Observations on the use of live and inactivated vaccines against sheep pox. Indian Veterinary Journal, 44:812-827.

Upton M, 1980. The economic importance of veterinary viral and tick-borne diseases on livestock production in Kenya. Report. Reading, UK: Pan Livestock Services Limited, Department of Agriculture, University of Reading.

Vannovski TY, 1955. Studies on goat pox under Central Asian conditions and its control. Nauk imeni Lenina. Stavropol, 1953, 57-63.

Wang SH, Jiang HX, 1988. Studies on attenuated goat pox virus vaccine. The manufacture of freeze-dried tissue culture goat pox modified virus vaccine. Acta Veterinaria et Zootechnica Sinica, 19(4):279-284; 4 ref.

Wang SH, Jiang HX, 1988. Vaccination of sheep against sheep pox with an attenuated goat pox vaccine. Chinese Journal of Veterinary Medicine, 14(12):36-38.

Woodroofe GM, Fenner F, 1962. Serological relationships within the poxvirus group, an antigen common to all members of the group. Virology, 16:334-341.

Yadav MP, Pandey AB, Negi BS, Sharma B, Shankar H, 1986. Studies on inactivated goat pox vaccine. Indian Journal of Virology, 2(2):207-221; 26 ref.

Zheng, M, Liu Q, Jin NY, Guo JG, Huang X, Li HM, Zhu W, Xiong Y, 2007. A duplex PCR assay for simultaneous detection and differentiation of Capripoxvirus and Orf virus. Molecular and Cellular Probes, 21:276-281.

Links to Websites

Top of page
WebsiteURLComment
CFSPH: Animal Disease Informationhttp://www.cfsph.iastate.edu/DiseaseInfo/index.php"Animal Disease Information" provides links to various information sources, including fact sheets and images, on over 150 animal diseases of international significance.
OIE Manual of Diagnostic Tests and Vaccines for Terrestrial Animalshttp://www.oie.int/en/international-standard-setting/terrestrial-manual/access-online/The Manual of Diagnostic Tests and Vaccines for Terrestrial Animals (Terrestrial Manual) aims to facilitate international trade in animals and animal products and to contribute to the improvement of animal health services world-wide. The principal target readership is laboratories carrying out veterinary diagnostic tests and surveillance, plus vaccine manufacturers and regulatory authorities in Member Countries. The objective is to provide internationally agreed diagnostic laboratory methods and requirements for the production and control of vaccines and other biological products.
OIE Technical Disease Cardshttp://www.oie.int/animal-health-in-the-world/technical-disease-cards/An updated compilation of 33 technical disease cards, containing summary information, mainly directed to a specialised scientific audience, including 32 OIE-listed priority diseases. USDA-APHIS (USA) are also credited with contributing to the maintenance of the cards.
OIE Terrestrial Animal Health Codehttp://www.oie.int/en/international-standard-setting/terrestrial-code/access-online/The OIE Terrestrial Animal Health Code sets out standards for the improvement of terrestrial animal health and welfare and veterinary public health worldwide, including through standards for safe international trade in terrestrial animals and their products. The health measures in the Terrestrial Code should be used by the veterinary authorities of importing and exporting countries to provide for early detection, reporting and control agents pathogenic to terrestrial animals and, in the case of zoonoses, for humans, and to prevent their transfer via international trade in terrestrial animals and terrestrial animal products, while avoiding unjustified sanitary barriers to trade.
USAHA: Foreign Animal Diseases. Seventh Editionhttp://www.aphis.usda.gov/emergency_response/downloads/nahems/fad.pdfCopyright © 2008 by United States Animal Health Association ALL RIGHTS RESERVED. Library of Congress Catalogue Number 2008900990 ISBN 978-0-9659583-4-9. Publication with 472pp. aimed at providing information for practitioners within the USA to prevent and or mitigate the incursion of foreign animal diseases into that country. Contains general chapters on surveillance, diagnosis, etc. as well as 48 chapters covering individual diseases, mostly those notifiable to the OIE.

Distribution Maps

Top of page
You can pan and zoom the map
Save map