Tomato yellow leaf curl virus
(leaf curl)

Pictures

Picture	Title	Caption	Copyright
Title Symptoms on leaves Caption Typical yellow leaf curl symptom on tomato (var. seeda) in Thailand. Affected plants exhibit upward and inward rolling of the leaf margins, interveinal yellowing of leaflets and marked stunting. Copyright Supat Attathom	Symptoms on leaves	Typical yellow leaf curl symptom on tomato (var. seeda) in Thailand. Affected plants exhibit upward and inward rolling of the leaf margins, interveinal yellowing of leaflets and marked stunting.	Supat Attathom
Title Symptoms on leaves Caption Typical yellow leaf curl symptom on tomato (var. seeda) infected with TYLCV in Thailand. Copyright Supat Attathom	Symptoms on leaves	Typical yellow leaf curl symptom on tomato (var. seeda) infected with TYLCV in Thailand.	Supat Attathom
Title Symptoms on leaves Caption Tomato plant infected with TYLCV from Spain; note upward and inward rolling of the leaf margins. Copyright Ian D. Bedford	Symptoms on leaves	Tomato plant infected with TYLCV from Spain; note upward and inward rolling of the leaf margins.	Ian D. Bedford
Title Symptoms on leaves Caption TYLCV damage symptoms to leaves; note interveinal yellowing of leaflets. Copyright Nicola Spence/Horticulture Research International	Symptoms on leaves	TYLCV damage symptoms to leaves; note interveinal yellowing of leaflets.	Nicola Spence/Horticulture Research International
Title Virus particles Caption Magnified electron micrograph showing morphology of TYLCV. Twin particles (right) are 18 x 36 nm. Copyright Supat Attathom	Virus particles	Magnified electron micrograph showing morphology of TYLCV. Twin particles (right) are 18 x 36 nm.	Supat Attathom
Title Single and twin virus particles Caption Electron micrograph of twin and single particles of TYLCV purified from infected tomato. Copyright Supat Attathom	Single and twin virus particles	Electron micrograph of twin and single particles of TYLCV purified from infected tomato.	Supat Attathom
Title DNA strand of TYLCV Caption Electron micrograph of closed circular single stranded DNA isolated from particles of TYLCV. Copyright Supat Attathom	DNA strand of TYLCV	Electron micrograph of closed circular single stranded DNA isolated from particles of TYLCV.	Supat Attathom

Identity

Preferred Scientific Name

• Tomato yellow leaf curl virus

Preferred Common Name

• leaf curl

Other Scientific Names

• tomato yellow leaf curl begomovirus

International Common Names

• English: tomato yellow leaf curl

English acronym

• TYLCV

EPPO code

• TYLCV0 (Tomato yellow leaf curl begomovirus)

Summary of Invasiveness

The wide global distribution of tomato crops and the dramatic outbreaks of the populations of the TYLCV vector, the whitefly Bemisia tabaci, led to a pandemic of this devastating disease. The virus probably arose in the Middle East between the 1930s and 1950s. Its global invasion began in the 1980s after the emergence of two strains: TYLCV-IL and TYLCV-Mld. The long-distance transportation of viruliferous whiteflies contaminating commercial shipments of tomato seedlings and ornamentals is probably the major reason for the virus pandemic (Caciagli, 2007). Sequence analyses allowed Lefeuvre et al. (2010) to trace the history of TYLCV spread. For instance, TYLCV-IL has invaded the Americas at least twice, once from the Mediterranean basin in 1992-1994 and once from Asia (a descendant of imported Middle Eastern TYLCV) in 1999-2003. As a result the estimated losses caused by TYLCV  reached about 20% of tomato production in the USA, and 30-100% in the Caribbean Islands, Mexico, Central America and Venezuela. Therefore several countries (Australia, EU) have established severe quarantine measures to control the whitefly vector.

Taxonomic Tree

• Domain: Virus
•     Unknown: "ssDNA viruses"
•         Unknown: "DNA viruses"
•             Family: Geminiviridae
•                 Genus: Begomovirus
•                     Species: Tomato yellow leaf curl virus

Notes on Taxonomy and Nomenclature

The name Tomato yellow leaf curl virus (TYLCV) was coined in the early 1960s to describe a virus transmitted by the whitefly Bemisia tabaci that affected tomato cultures in Israel (Cohen and Harpaz, 1964). Early diagnosis of TYLCV was essentially based on symptom observation, although symptoms vary greatly as a function of soil, growth conditions and climate. Serology has been of limited use because whitefly-transmitted geminiviruses share many epitopes (Thomas et al., 1986; Chiemsombat et al., 1991). The analysis of DNA sequences has become the tool of choice, allowing one to accurately identify the virus and to evaluate its relationship with other TYLCV isolates. Viruses with nucleotide sequence homology of more than 90% are generally considered to be strains of the same virus; viruses with homologies of less than 90% are considered as different virus species (Padidam et al., 1995). The Seventh Report of the International Committee on Taxonomy of Viruses (van Regenmortel et al., 2000) places TYLCV in the genus Begomovirus of the family Geminiviridae, which includes whitefly-transmitted viruses with either a genome split between two genomic molecules DNA A and DNA B (bipartite) or with a single genomic DNA A-like molecule (monopartite).

Sequence comparisons have revealed that TYLCV was the name given to a complex of closely as well as distantly related begomoviruses affecting tomato worldwide (Picó et al., 1996; Nakhla and Maxwell, 1998). Nucleotide and phylogenetic analyses have allowed separation of the begomoviruses affecting tomato into several groups and a nomenclature has been proposed to reflect this classification (Fauquet et al., 2000). Accordingly, Tomato yellow leaf curl virus (TYLCV) is the name of the virus isolated in Israel. Hence this datasheet will refer only to the TYLCV complex, not to the other, different, tomato begomoviruses.

Seven different species belonging to the Tomato yellow leaf curl virus cluster have been identified (Abhary et al., 2007; Czosnek, 2008). The members of the TYLCV group, updated as of 2008, are listed below. The species names are written in italics, the strain names are not italicized and can be abbreviated. Some strain (TYLCV-Iran; TYLCV-Gezira) and isolate descriptors (TYLCV-[Israel:Rehovot:1986]) are added to the name. The descriptor of the strain level is written before the square brackets, while the isolate descriptors are between brackets and are composed of the country, the location and the year of sampling, when available. The Genbank accession number of the DNA sequence is listed.

1. Isolates related to Tomato yellow leaf curl virus from Israel (TYLCV-IL)
1.1. TYLCV - Israel [Israel:Rehovot:1986, X15656)
1.2. TYLCV - Israel [China:Shangai 2:2005] (TYLCV-IL[CN:SH2:05], AM282874)
1.3. TYLCV - Israel [Cuba] (TYLCV-IL[CU], AJ223505)
1.4. TYLCV - Israel [Dominican Republic] (TYLCV-IL[DO], AF024715)
1.5. TYLCV - Israel [Egypt:Ismaelia] (TYLCV-IL[EG:Ism], AY594174)
1.6. TYLCV - Israel [Egypt:Nobaria:1991] (TYLCV-IL[EG:Nob:91], EF107520)
1.7. TYLCV - Israel [Italy:Sicily:2004] (TYLCV-IL[IT:Sic:04], DQ144621)
1.8. TYLCV - Israel isolates from Japan (Haruno, Misumi, Miyazaki, Omura:Eustoma, Omura, Tosa; with respective Genbank accession number AB192966, AB116631, AB116629, AB116630, AB110217, AB192965)
1.9. TYLCV - Israel [Jordan:Tomato:2005] (TYLCV-IL[JO:Tom:05], EF054893)
1.10. TYLCV - Israel [Lebanon:Tomato:2005] (TYLCV-IL[LB:Tom:05], EF051116)
1.11. TYLCV - Israel [Mexico:Culiacan:2005] (TYLCV-IL[MX:Cul:05], DQ631892)
1.12. TYLCV - Israel [Morocco:Berkane:2005] (TYLCV-IL[MO:Ber:05], EF060196)
1.13. TYLCV - Israel [Puerto Rico:2001] (TYLCV-IL[PR:01], AY134494)
1.14. TYLCV - Israel [Spain:Almeria:Pepper:1999] (TYLCV-IL[ES:Alm:Pep:99], AJ489258
1.15. TYLCV - Israel [Tunisia:2005] (TYLCV-IL[TN:05], EF101929)
1.16. TYLCV - Israel [Turkey:Mersin:2004] (TYLCV-IL[TR:Mer:04], AK812277)
1.17. TYLCV - Israel [US:Florida] (TYLCV-IL[US:Flo], AY530931)

2. Isolates related to Tomato yellow leaf curl virus - Mild from Israel (TYLCV-Mld)

2.1. TYLCV - Mild [Israel:1993] (TYLCV-Mld[IL;93], X76319)
2.2. TYLCV - Mild isolates from Japan (Aichi, Atumu, Daito, Kisozaki, Osuka, Shimizu, Shizuoka, Yaizu; with respective Genbank accession number  AB014347, AB116633, AB116635, AB116634, AB116636, AB110218, AB014346, AB116632)
2.3. TYLCV - - Mild [Jordan:Cucumber:2005] (TYLCV-Mld[JO:Cuc:03], EF158044)
2.4. TYLCV - Mild [Jordan:Homra:2003] (TYLCV-Mld[JO:Hom03], AY594175)
2.5. TYLCV - Mild [Jordan:Tomato:2005] (TYLCV-Mld[JO:Tom:03], EF054894)
2.6. TYLCV - - Mild [Lebanon;LBA44:05] (TYLCV-Mld[ILB;LBA44:05], EF185318)
2.7. TYLCV - Mild [Portugal:2:1995] (TYLCV-Mld[PT:2:95], AF105975)
2.8. TYLCV- Mild [Reunion:2002] (TYLCV-Mld[RE:02],AJ865337)
2.9. TYLCV- Mild [Spain:72:1997] (TYLCV-Mld[ES:72:97],AF071228)
2.10. TYLCV - Mild [Spain:Almeria:1999] (TYLCV-Mld[ES:Alm:99], AJ519441)  

3. Isolates related to Tomato leaf curl Sudan virus ToLCSDV

3.1. ToLCV - Gezira [Sudan:1996] (ToLCV-Gez[SD:96], AY044138)
3.2. ToLCV - Shambat [Sudan:Shambat:1996] (ToLCSDV-Sha[SD:Sha:96], AY044139)
3.3. ToLCV - Yemen [Yemen:Tihamah:2006] (ToLCSDV-YE[YE:Tih:06], EF110890)

4. Tomato yellow leaf curl Axarquia virus - [Spain:Algarrobo:2000] (TYLCAxV-[ES:Alg:00], AY227892)

5. Tomato yellow leaf curl Malaga virus - [Spain:421:1999] (TYLCMalV-[ES:421:99], AF271234)

6. Isolates related to Tomato yellow leaf curl Mali virus TYLCMLV

6.1. TYLCMLV - Ethiopia [Ethiopia:Melkassa:2005] (TYLCMLV-ET[ET:Mel:05], DQ358913)
6.2. TYLCMLV - Mali [Mali] (TYLCMLV-ML[ML], AY502934)

7. Tomato yellow leaf curl virus - Iran (TYLCV-IR[IR], AJ132711)

Other TYLCV-related begomoviruses (Tomato yellow leaf curl China virus, Tomato yellow leaf curl Kanchanaburi virus, Tomato yellow leaf curl Malaga virus, Tomato yellow leaf curl New Delhi virus, Tomato yellow leaf curl Sardinia virus and Tomato yellow leaf curl Thailand virus) are the object of separate entries in the Compendium. This classification is rendered even more complicated by the recent discovery that recombination between species of geminiviruses happens relatively frequently (Padidam et al., 1999). Naturally occurring recombination has been recently found in the Almeria region, southern Spain, between TYLCV and TYLCSV, probably because the two virus species are co-existing in the tomato plants grown in the field and the greenhouse (Navas-Castillo et al., 2000; Monci et al., 2001) and even in the same nucleus (Morilla et al., 2004).

Additional begomoviruses affecting tomato cultures have not been assigned to the TYLCV family. In India, South-East Asia and in Australia, the prevalent virus was named Tomato leaf curl virus (ToLCV). In the Americas, the viruses were termed Tomato mottle virus in Florida (TMoV), Tomato leaf crumple virus (ToLCrV), formerly named Chino del tomate virus (CdTV), in Mexico Tomato golden mosaic virus (TGMV), in Central and South America Tomato severe leaf curl virus (ToSLCV), in Central America, Tomato yellow mosaic virus (ToYMV), Tomato yellow mottle virus (ToYMoV) and Tomato yellow vein streak virus (ToYVSV) in South America. These viruses clearly differ from the various TYLCVs in the symptoms they induce on tomato, their host range, their nucleotide sequence, and in their reaction with panels of monoclonal antibodies (Polston and Anderson, 1997).

Description

TYLCV has a characteristic twinned morphology (Czosnek et al., 1988). The TYLCV capsid (total MW 3,330,000), like that of other geminiviruses (Zhang et al., 2001), consists of two joined, incomplete icosahedra, with a T=1 surface lattice containing a total of 22 capsomeres, each containing five units of a 260 amino acid coat protein (CP) of 30.3 kDa. TYLCV has a single 2787 nucleotides (total MW 980,000) covalently closed genomic circular ssDNA (Navot et al., 1991). Although all the Mediterranean and Middle Eastern TYLCV isolates have a single genomic component of similar size. TYLCV encodes two large open-reading frames (ORF) on the viral strand (V1 and V2), and four on the complementary strand (C1-C4). V1 encodes CP, and V2 encodes a movement-like protein (MP) with suppressor of RNA silencing properties. C1 encodes a replication-associated protein (Rep), C2 a transcriptional activator protein (TrAP), C3 a replication enhancer protein (REn) and C4 a symptom and movement determinant (Díaz-Pendón et al., 2010; Scholthof et al., 2011). TYLCV DNA includes an intergenic region containing a 29 nucleotide-long, stem-loop structure with the conserved nanonucleotide TAATATTAC, which serves as cleaving site during replication of the viral genome, according to the rolling circle model (Laufs et al., 1995).

Distribution

Europe

France: Reported in 1999 in a single field in the Camargue district. Surveys conducted in 2000 have indicated that the eradication measures taken have been successful (Dalmon et al., 2000; Lepoivre, 2001).

Greece: In late summer 2000, tomatoes grown in greenhouses in several locations in Crete, Attiki and southern Peloponnese showed severe TYLCV symptoms. All greenhouses with infected plants were infested with high populations of Bemisia tabaci. Partial sequencing indicated identity with the TYLCV strain from Israel (Avgelis et al., 2001).

Italy: First recorded in Sardinia in 1988 (Gallitelli et al., 1991), then in Sicily in 1989 (Credi et al., 1989) and in Calabria in 1991 (Polizzi and Areddia, 1992). The disease is associated with large populations of B. tabaci (Rapisarda, 1990). Two different, but related, isolates have been sequenced: from Sardinia (TYLCSV, Kheyr-Pour et al., 1991) and from Sicily (TYLCSV-Sic, Crespi et al., 1995).

Portugal: In late summer 1995, an epidemic outbreak of a disease associated with B. tabaci seriously affected tomato crops in the Algarve, a region in southern Portugal where tomatoes are cultivated year round (Louro et al., 1996). The disease occurred mainly in greenhouse crops where up to 100% of autumn crops were affected and yield was drastically reduced. So far the disease appears to be limited to the Algarve region. Sequencing has indicated that the virus (TYLCV-PT) is genetically related to TYLCV from Israel.

Spain: In 1992, a virus closely related to the Sardinian isolate of TYLCV was found in tomato fields in Almeria and Malaga (Moriones et al., 1993). A survey in 1997 showed that both the Israeli (TYLCV) and Sardinian isolates (TYLCSV) are widely distributed in southern Spain (Sanchez-Campos et al., 1999). Recombinants between the two viruses have been found (Monci et al., 2001). In 1999, TYLCV was reported in Phaseolus bean (Navas-Castillo et al., 1999). TYLCV has recently been diagnosed in the Canary Islands (Font et al., 2000).

Switzerland: Present, but identity has not been confirmed by sequencing (Pelet, 1992).

Asia

Bangladesh, Laos, Malaysia, Myanmar and Vietnam: Present, identified by sequencing. Five distinguished TYLCV isolates were identified, only that from Bangladesh had a bipartite genome (Green et al., 2001).

Bahrain: Present; identity has not been confirmed by sequencing (Traboulsi, 1994).

China: Increasingly prevalent and leading to serious yield losses especially in the south-western provinces of Yunan and Guangxi (Yin et al., 2001). Sequencing showed that TYLCV from China (TYLCCNV) is different from the known Mediterranean and Asian TYLCV isolates (Yongping et al., 2008).

Cyprus: Observed for the first time in 1974. Endemic in the southern coastal zone (Ioannou, 1987).

Iran: Prevalent in the southern provinces of Iran (Hajimorad et al., 1996). Sequencing indicated that TYLCV from Iran (TYLCV-IR) is related to the Middle Eastern TYLCV isolates (Bananej et al., 1998). An important centre of TYLCV diversity (Lefeuvre et al., 2010).

Iraq: Present; identity not confirmed by sequencing (Wilson et al., 1981).

Israel: Present since the early 1960s in the Jordan valley and the coastal plain (Cohen and Harpaz, 1964; Cohen and Nitzany, 1966; Czosnek et al., 1988). It is the most significant factor reducing yield in summer and autumn. The first TYLCV isolate to be sequenced (Navot et al., 1991).

Japan: Restricted distribution on tomato. Seven isolates have been sequenced (see Notes on taxonomy and Nomenclature; closely related to TYLCV from Israel (Kato et al., 1998).

Jordan: Present in the Jordan Valley; affects productivity in open field and greenhouse (Makkouk, 1978). Sequencing showed a complex of TYLCV-IL and TYLCSV-ES (Anfoka et al., 2008).

Korea: Rapidly spread to most regions of the Southern Korean peninsula after 2008. Sequencing of TYLCV and of mitochondrial cytochrome oxydase I from B. tabaci showed that TYLCV and its vector were introduced from Japan (Lee et al., 2010).

Kuwait: Widespread, causing a devastating disease of field-grown tomatoes since 1993 (Montasser et al., 1999).

Lebanon: Widespread in the coastal plains (Makkouk et al., 1979). The virus is closely related to other Middle Eastern TYLCV isolates (Abou-Jawdah et al., 1999).

Oman: Present; identity not confirmed by sequencing (Zouba et al., 1993; Azam et al., 1997).

Saudi Arabia: Present in the Al-Kharj and Qasim regions where it reaches epidemic proportions in summer plantations (Mazyad et al., 1979). Two different viruses have been isolated and partially sequenced: a Northern isolate (TYLCV-NSA) related to TYLCV from Israel, and a Southern isolate (TYLCSAV-SSA) (Hong and Harrison, 1995).

Thailand: A TYLCV disease broke out in 1978 associated with large populations of B. tabaci (Thanapase et al., 1983; Thongrit et al., 1986). TYLCV from Thailand (TYLCTHV) possesses a bipartite genome (Attathom et al., 1994; Rochester et al., 1994) whereas the other known TYLCV isolates are monopartite (Navot et al., 1991).

Turkey: Observed first in the Cukurova region, Adana province (Yilmaz et al., 1980) and more recently (1993) in the Aegean region. An isolate was found to be almost identical to the TYLCV from Israel (Morris, 1997).

Yemen: Increasing whitefly-related virus problems have been observed in tomato-growing regions since the 1970s. The virus is present in the Abayan and Hadramauvat regions. Partial sequencing has indicated that TYLCV from Yemen (TYLCYV) is distinct from the other TYLCV isolates (Bedford et al., 1994).

Africa

Algeria: Found in glasshouses on tomato and green capsicums, in association with large whitefly populations (Kerkadi et al., 1998). Identity not confirmed by sequencing.

Burkina Faso: The virus is found in many parts of the country but the incidence of disease varies from year to year; identity not confirmed by sequencing (Konate et al., 1995).

Cape Verde: The most important disease affecting tomato (Defrancq D'hondt and Russo, 1985). Omnipresent on Santiago Island (Czosnek and Laterrot, 1997); its identity has not been confirmed by sequencing.

Côte d’Ivoire: Virus present in the Bouake region (Czosnek and Laterrot, 1997); identification not confirmed by sequencing.

Egypt: TYLCV has invaded tomato plantations throughout lower and middle Egypt since 1989. Widespread in Fayoum, Ismailia and Giza (Mazyad et al., 1986), the virus is quasi-identical to the TYLCV isolate from Israel (Nakhla et al., 1993).

Libya: Present (Traboulsi, 1994); identity not confirmed by sequencing.

Mali: Present in the Bamako region (Czosnek and Laterrot, 1997); identity confirmed by sequencing (Zhou et al., 2008).

Morocco: First found in 1998 on tomato crops in the coastal region near Casablanca, TYLCV was identified by sequencing (Peterschmit et al., 1999). At the same time, symptoms were also seen in tomato crops in the north-eastern region of Morocco, causing crop losses of between 20 and 100%. Probably imported into Morocco on grafted tomato plants from the Netherlands. It constitutes a major problem today (Monci et al., 2000).

Nigeria: Present in the Zaria region. Identification confirmed by sequencing (Hong and Harrison, 1995). TYLCV from Nigeria (TYLCNV) is not closely related to other TYLCV isolates.

Réunion Island: TYLCV-Mld was introduced in 1997 and TYLCV-IL in 2004. A 5-year survey (2004-2008) of the viral population implicated in the tomato yellow leaf curl disease showed that TYLCV-IL was found to rapidly displace TYLCV-Mld. In 2008, TYLCV-Mld was only found in co-infections with TYLCV-IL (Delatte et al., 2007).

Senegal: Widespread along the Senegal River, Casamance and Dakar regions where many tomato fields have been abandoned (Defrancq D'hondt and Russo, 1985).

Sudan: Identified in the early 1960s (Yassin and Nour, 1965); widespread in tomato-growing regions (Yassin, 1989). Two distinct viral genotypes were identified in the same tomato plant collected from Gezira, Sudan; a third genotype was identified in tomato samples collected in Shambat (Idris and Brown, 2005).

Tanzania: Widespread and economically important. A virus species distinct from the Mediterranean isolates has been sequenced (Chiang et al., 1997).

Tunisia: Present in the regions of Tunis, Sousse and Southern oasis (Cherif and Russo, 1983; Czosnek and Laterrot, 1997). Identity was confirmed by sequencing (Chouchane et al., 2007).

Western Hemisphere

Bahamas: A virus with a sequence similar to the TYLCV isolate from Israel has been identified (Sinisterra et al., 2000).

Cuba: TYLCV was first detected in the early 1990s and is now widespread. Sequencing indicated a close relationship with the TYLCV isolate from Israel (Martinez-Zubiaur et al., 1996; Ramos et al., 1996). It has also been reported in pepper (Quiñones et al., 2002).

Dominican Republic: The virus was first identified as TYLCV in 1992. Sequencing has indicated that the virus is closely related to TYLCV from Israel (Nakhla et al., 1994; Polston et al., 1994). Widespread.

Grenada: In 2007, severe symptoms of tomato yellow leaf curl disease were observed on tomato in six sites on Grenada Island. Sequencing confirmed the presence of TYLCV-IL (Lett et al., 2011).

Jamaica: The most widespread tomato disease, often resulting in 100% crop loss. Since 1991, farmers in south St. Elizabeth have reported losses in their tomato crops to 'jherri curl' disease, which is caused by TYLCV. Sequencing has indicated that this virus is similar to the Eastern Mediterranean TYLCV isolates (Wernecke et al., 1997).

Mexico: In 1999, samples collected in Yucatan were found to be infected by TYLCV (Ascencio-Ibanez et al., 1999). In 2005, TYLCV was identified in Sinaloa (Brown and Idris, 2006).The current incidence of the disease is low and the virus is spreading slowly. The TYLCV isolates from Mexico are closely related to the Eastern Mediterranean TYLCV (Duffy and Holmes, 2007).

Puerto Rico: Found in 2001 in one tomato field on the southern coast of the island (Bird et al., 2001).

Trinidad and Tobago: Widespread, causes a serious threat to the tomato industry (Umaharan et al., 1998). Identity not confirmed by sequencing.

USA

Florida: The first report of TYLCV in the USA came from commercial plantings from Virginia. The tomato plants had been produced in a screenhouse in Manatee county, Florida (Polston, 1998). In July 1997, symptoms characteristic of TYLCV were observed on one tomato plant in a field in Collier County and on several tomato plants in a garden centre in Sarasota. Sequencing indicated that the virus was closely related to TYLCV-IL (Polston et al., 1999a, b). In October 1998, the virus was found in Gadsen County, northern Florida. Spreading, now present in almost all tomato-growing counties (Polston et al., 1999a).

Georgia: First found in Decatur County (south Georgia), with few occurrences since. Identity has been confirmed by sequencing (Momol et al., 1999).

Louisiana: Present, confirmed by sequencing (Valverde et al., 2001).

North Carolina: Symptoms observed in the summers of 2000 and 2001 in Henderson County. The sequence was closely related to the Eastern Mediterranean TYLCV isolates (Polston et al., 2002).

Mississipi: In January 2001, mild symptoms were observed in a greenhouse tomato production operation in east-central Mississippi. Whiteflies were present in the greenhouse during the previous month, but in relatively low numbers. PCR indicated the presence of TYLCV but the strain was not determined (Ingram and Henn, 2001).

Arizona: TYLCV found in the region of Phoenix in 2006, close to TYLCV-IL (Idris et al., 2007).

Venezuela: During 2004, tomato plants showing symptoms similar to those of TYLCV were observed in commercial fields in Zulia state. Sequencing of PCR amplicons from tomato plants sampled in the field showed the presence of TYLCV homologous to TYLCV-Mld from Spain and Portugal and TYLCV from Israel and Mexico (Zambrano et al., 2007).

Distribution Table

The distribution in this summary table is based on all the information available. When several references are cited, they may give conflicting information on the status. Further details may be available for individual references in the Distribution Table Details section which can be selected by going to Generate Report.

History of Introduction and Spread

Within less than 25 years TYLCV has spread from the Middle East to North America, Africa, Europe and Far East Asia (Czosnek, 2010). In 1959 tomatoes grown in the Jordan valley, Israel, became infected by an agent identified as a whitefly-transmitted viral agent. The virus was named Tomato yellow leaf curl virus (TYLCV) (Cohen and Harpaz, 1964). It was isolated in 1988, proven to be monopartite and sequenced in 1991 (Czosnek et al., 1988; Navot et al., 1991). From the early 1960s, Tomato yellow leaf curl disease has quickly spread to the entire Middle East and is presently found in many regions of Africa, America and Asia. It was reported in the mid and late 1970s in Cyprus, Jordan and Lebanon. It was identified in Egypt and Turkey in the early 1980s, and in the mid-late 1990s in Iran, the Asian republics of the former USSR, Japan, Saudi Arabia and Yemen. In the early 1990s, the disease has been identified in Italy, Spain and Portugal, and later in France and Greece. In Morocco and Tunisia it was identified in the early 2000s. In East Africa, Tomato yellow leaf curl disease was present in Sudan as early as the late 1970s. In the Réunion Island the disease was detected in the late 1990s. It has appeared in the Western Hemisphere in the mid-1990s in the Caribbean Islands, first in the Dominican Republic, then Cuba, Jamaica, Puerto Rico and the Bahamas. From there, the disease has reached the USA, identified first in Virginia in the late 1990s, then in Florida, Georgia, Louisiana, North Carolina and Mississippi. Tomato yellow leaf curl disease has been identified in several regions of Australia (2003), Mexico (2007), in Arizona and in California (2007).

Sequencing of begomoviruses inducing Tomato yellow leaf curl disease has shown that it was not induced by a single virus species. The TYLCV type from Israel has been found in regions as diverse as Spain (Moriones and Navas-Castillo, 2000), Japan (Kato et al., 1998), China (Wu et al., 2006), Australia (Tesoriero and Azzopardi, 2006) and Venezuela (Zambrano et al., 2007). A second TYLCV species was described in Israel and coined Tomato yellow leaf curl virus Mild (TYLCV-Mld) (Antignus and Cohen, 1994). A new TYLCV-like species was discovered in Sardinia Italy in the early 1990s and was named Tomato yellow leaf curl Sardinia virus (TYLCSV) (Kheyr-Pour et al., 1991). A relative of TYLCSV was identified in Sicily (Crespi et al., 1995). TYLCSV has spread since to Spain, Morocco and Tunisia (Sánchez-Campos et al., 1999; Chouchane et al., 2006; El Mehrach et al., 2007). TYLCV and TYLCSV recombinants have also been found (Monci et al., 2001). The spread of TYLCV westward causing the displacement of the endogenous TYLCSV, especially in Spain (Sánchez-Campos et al., 1999) and the invasion of the Americas have led to the assumption that TYLCV-associated diseases radiate from the Middle East. However in a recent study, besides the endogenous TYLCV and TYLCV-Mld species, the Sicilian strain of TYLCSV and a Spanish strain of TYLCSV (TYLCSV-ES) have been found in Jordan and Israel demonstrating that TYLCSV has spread eastward (Anfoka et al., 2008).

Recent multiple introduction of members of the TYLCV complex in Spain provides an excellent model to analyse aspects of adaptation and evolution of an invading virus population (Sánchez-Campos et al., 1999, 2002). Initial colonization with isolates of the Spanish strain of Tomato yellow leaf curl Sardinia virus (TYLCSV-ES) during the early 1990s, resulted in a relatively stable population in which reduced genetic diversity was observed (Sánchez-Campos et al., 2002). Subsequent introductions of TYLCV and TYLCV-Mld (Navas-Castillo et al., 1999; Morilla et al., 2003) resulted in novel sources of variation and conditions for recombination to occur. This was the case of the novel recombinant variant named Tomato yellow leaf curl Málaga virus (TYLCMalV) that emerged as a result of a genetic exchange between TYLCSV-ES and TYLCV-Mld. This natural recombinant variant showed to be better adapted ecologically than either parental virus and spread rapidly in the population (Monci et al., 2002).

The Réunion Island provides a case study of a multiple introduction and spread of exotic TYLCV and its vector in a closed environment TYLCV-Mld was introduced in 1997 and TYLCV-IL in 2004. A 5-year survey (2004-2008) of the viral population showed that TYLCV-IL was found to rapidly displace TYLCV-Mld. In 2008, TYLCV-Mld was only found in co-infections with TYLCV-IL. This TYLCV switch was paralleled with the invasion of the B. tabaci B biotype, displacing the local Ms biotype (Delatte et al., 2006, 2007).

Smuggling of infected plants, commercial shipment of infected seedlings, translocation of viruliferous whiteflies by winds, or by plane transportation (e.g. on ornamentals) can be instrumental in the expansion of TYLCV. The newcomer may have a better interaction with the whitefly vector than the endogenous geminiviruses. For example, the new recombinant TYLCMalV became prevalent in Spain because of its better acquisition by the whiteflies and its broader host range than both of its parents (Monci et al., 2002).

Introductions

Habitat List

Hosts/Species Affected

The domesticated tomato (Solanum lycopersicum) is the primary host of TYLCV. Most of the wild tomato species such as S. chilense, S. habrochaites, S. peruvianum and S. pimpinellifolium include accessions that are symptomless carriers (Zakay et al., 1991) or are immune (Vidavsky and Czosnek, 1998) to the virus. Several cultivated plants are hosts of TYLCV and present severe symptoms upon whitefly-mediated inoculation: bean (Phaseolus vulgaris), petunia (Petunia hybrida) and lisianthus (Eustoma grandiflorum). Weeds such as Datura stramonium and Cynanchum acutum present distinct symptoms whereas others such as Malva parviflora are symptomless carriers. A recent survey in Cyprus showed that 49 different species belonging to the families Amaranthaceae, Chenopodiaceae, Compositae, Convolvulaceae, Cruciferae, Euphorbiaceae, Geraniaceae, Leguminosae, Malvaceae, Orobanchaceae, Plantaginaceae, Primulaceae, Solanaceae, Umbelliferae and Urticaceae were TYLCV hosts (Papayiannis et al., 2011). Plants used to rear whiteflies, such as cotton and aubergine, are immune to the virus. Experimental hosts of the virus include tomato (S. lycopersicum) and jimsonweed (D. stramonium).

Host Plants and Other Plants Affected

Growth Stages

Symptoms

List of Symptoms/Signs

Biology and Ecology

Transmission

TYLCV is transmitted by the whitefly, Bemisia tabaci (Cohen and Harpaz, 1964), which is commonly found in tropical and subtropical countries. B. tabaci has a very wide host range of at least six plant families (Cohen and Antignus, 1994). Colonies of B. tabaci are usually established under laboratory conditions on TYLCV non-host plants such as cotton, aubergine or jimsonweed (Datura stramonium) in a greenhouse or in a growth chamber.

Virus-Vector Relationship

TYLCV is transmitted naturally by B. tabaci in a persistent manner. The efficient acquisition access period is 15-30 minutes, the latent period is 8-24 hours, and the efficient inoculation access period is at least 15 minutes (Cohen and Nitzany, 1966; Mansour and Al-Musa, 1992; Mehta et al., 1994; Ghanim et al., 2001). The virus can be detected in every stage of vector development (Ghanim et al., 1998). Female B. tabaci are more efficient vectors than males; transmission capacities decrease as the insect ages (Czosnek et al., 2001). Following a 48 h acquisition access period on infected tomato, TYLCV DNA remains associated with B. tabaci for the entire adult life of the insect; infectivity decreases with time, but remains significant (Rubinstein and Czosnek, 1997). Symptoms develop on inoculated tomato seedlings 2 to 3 weeks after insect-mediated inoculation. The presence of TYLCV in the egg of the whitefly vector suggests transovarial passage (Ghanim et al., 1998).

Epidemiology

Tomato yellow leaf curl disease can be observed in tomato fields throughout the affected regions. The virus is transmitted to tomato plants after vector feeding on infected tomato plants or alternative hosts. The disease is first observed on tomato seedlings about 3 weeks after transplanting. Disease incidence increases rapidly and can reach 100% infection at harvest. In nature, the virus is only transmitted by the whitefly B. tabaci. In affected regions, the incidence of the disease is directly correlated with the pressure of the whitefly population (Mazyad et al., 1979).

TYLCV epidemiology has been studied thoroughly in the Jordan Valley, Israel (Cohen, 1990). B. tabaci populations start to increase in May-June and peak in September-October and decrease to minimum levels in December. The gender prevalent in the whitefly population varies from predominantly males in the winter to predominantly females in the summer. The weed Cynanchum acutum seems to be the overwintering reservoir of the virus, although it is a poor host for B. tabaci. There is a positive correlation between B. tabaci population size and the spread of TYLCV. Winds influence the spread of the virus. The main flight activity takes place during the morning hours, sometimes with a short peak in the late afternoon. The longest flight distance measured was 7 km. During the peak whitefly season, which corresponds to the time of tomato planting (August-September), 2000 to 20,000 whiteflies land weekly on each square metre, thus ensuring high levels of infection within a short time. At this time, the maximum level of whiteflies able to transmit TYLCV to test plants in the laboratory is 4-5% of the population present in the field.

Using DNA probes, the time course of infection has been followed recently in the coastal plain, Israel, where TYLCV infection and whitefly populations are at their peak during August to October (Vidavski et al., 1998). Samples were taken every 7-10 days from the shoot apex of 122 plants up to 89 days after transplanting and tested for the presence of viral DNA using the squash blot hybridization procedure (Navot et al., 1989). Inoculation in the field seems to be at random, as the location of plants free of viral DNA does not point to 'hot spots' of escapes. Although the field was swarming with whiteflies from the first day of planting, only 32% of plants exhibited detectable amounts of viral DNA 17 days after transplanting. This value increased to 64% 39 days after transplanting and to 90% 60 days thereafter. Thus, even 3 months after planting, about 10% of the plants did not contain detectable amounts of viral DNA. Such a high level of escapes may interfere in the selection of resistant/tolerant individuals and makes progress in the breeding programme problematic.

Climate

Air Temperature

Means of Movement and Dispersal

In nature, the dispersal of TYLCV is dependent on the movement of its sole vector , the whitefly Bemisia tabaci. Insects are usually sedentary. Once they land on a tomato plant, they feed and lay eggs. In the infected tomato field, it is common for a single plant to host several hundred insects. Whiteflies seldom move to another plant unless disturbed by winds, animals or human activities. It seems that the various whitefly biotypes disperse equally (Matsuura and Hoshino, 2008). Studies carried out in the Jordan Valley in Israel have shown that B. tabaci is able to fly (or be carried by air streams) for distances greater than 10 km (Cohen et al., 1988). Entire whitefly populations move from one host to another, especially during harvesting, for example, from cotton to nearby tomato fields, or from pepper to tomato (tomato is harvested later than cotton and pepper).

The movement of B. tabaci biotypes is intricately related to the movement of TYLCV. The accidental import of B. tabaci in several countries is well documented (Caciagli, 2007). Biotype A was taken to Brazil in 1928 and biotype B in the early 1990s (Oliveira et al., 2005). Biotype B was imported to the USA sometimes before 1986 and then invaded the southern states (Culotta, 1991). Whiteflies can sustain temperature and humidity prevalent during international transportation by air or ship. Once B. tabaci is present it is almost impossible to eradicate despite quarantine restrictions (Kahan, 1982). Illegal smuggling of agricultural produce is a major factor in the invasion of viruses and their insect vectors. The introduction of TYLCV in the USA was traced back to illegal introduction of B. tabaci B biotype. Prior to the appearance of this insect, only three viruses were known to infect tomato in the Western Hemisphere, but none occurred in the USA. However within 10 years, 17 highly damaging geminiviruses had appeared and were causing enormous losses in tomato production throughout the Western Hemisphere (Polston and Anderson 1997). For example, just prior to 1992, TYLCV was introduced on tomato transplants probably from Israel into the Dominican Republic. One year later this whitefly-geminivirus combination destroyed tomato production in the Dominican Republic (Polston et al., 1994). TYLCV soon appeared in Jamaica and Cuba, and in 1997 it was discovered in Florida (Polston et al., 1999). From there, TYLCV quickly invaded the southern states of the USA and Mexico.  

Seedborne Aspects

Pathway Causes

Pathway Vectors

Plant Trade

Vectors and Intermediate Hosts

Impact Summary

Impact

TYLCV was first described from Israel and until the late 1980s was known as a problem in the eastern Mediterranean. Since then, the geographic distribution of TYLCV has increased to include countries in the Western Mediterranean, Central Asia, North and sub-Saharan Africa, the Caribbean, Mexico, the USA, Central and Southern America, Japan and Australia. TYLCV causes heavy economic losses wherever it occurs, although initially after introduction losses may be relatively low. Although TYLCV has a broad host range, infecting more than 30 species in over 12 plant families, it is primarily known as one of the most damaging viruses to infect tomatoes. The virus affects yields by greatly reducing the number of fruit produced. Fruit developing at the time of infection remain on the plant, but very few fruit will set once infection has occurred. Experimental studies from many locations document the dramatic effect that TYLCV has on the yield of tomato. Inoculation of tomato plants 3 weeks after transplanting in the field in Lebanon showed a 63% reduction in yield compared with non-infected plants (Makkouk et al., 1979). Studies in the glasshouse in Jordan revealed that inoculation with TYLCV 10 weeks after sowing reduced yields by 63%, whereas inoculations at 15 weeks did not reduce yields significantly (Al-Musa, 1982). In cultivar evaluation trials in Cyprus, yields of more than half the cultivars tested were reduced by 50 to 80% (Ioannou, 1985). Field trials in Israel using tomato transplants of susceptible cultivars inoculated at the first true leaf stage, demonstrated a 99% reduction in the yield of inoculated plants compared with non-inoculated plants (Pilowsky et al., 1993). In field studies in Turkey, two susceptible tomato cultivars showed yield reductions of 60 and 70%, respectively. In a study in commercial tomato fields in Florida, TYLCV significantly reduced the number of fruit, but not the fruit size, compared with non-infected plants (Polston et al., 1999b). The younger the plants were at the time of infection, the more severe the reduction in fruit number.

Documentation of losses to commercial production, although dramatic, is rare. Severe reductions in tomato yields in 1995 were reported from Portugal (Louro et al., 1996). A survey conducted in Réunion Island from 1997 to 1998 indicated that of 123 commercial sites examined, 52 had at least one TYLCV infected plant; of these, 11 exhibited a 40-60% yield reduction, and 14 a 60-100% yield reduction (Peterschmit et al., 1999). In the Dominican Republic, annual yield losses for the Azua valley in the southern part of the country ranged between 20 and 95% from 1988 to 1995. In the northern part of the Dominican Republic, annual losses for that region peaked in 1993 at 80% (Alvarez and Abud-Atun, 1995). Losses of 30% were reported from Cuba for the 1990-1991 season (Calixto et al., 1995). Another report states a 100% loss of tomato crops from the La Habana area of Cuba (Ramos et al., 1996). In the USA, incidences of TYLCV-infected tomatoes have remained low due in part to aggressive intervention by tomato growers. Most growers suffered only minor losses in 1997-2000 production seasons, although a few growers (less than 10%) had greater than 50% crop loss in 1998.

In addition to tomato, TYLCV was reported to cause severe losses in bean (Phaseolus vulgaris) in commercial production in Israel (Navot et al., 1992) and in southern Spain (Navas-Castillo et al., 1999), and the virus was reported to be a limiting factor in the production of lisianthus (Eustoma grandiflora) in Israel (Cohen et al., 1995).

Environmental Impact

Whitefly populations are usually controlled with heavy, sometimes daily, insecticides sprays. More than 50 conventional insecticides are registered for use against B. tabaci. Most insecticides are not selective and also destroy the whitefly natural enemies. Some whitefly biotypes have developed resistance to most insecticides. The Q biotype present in the Middle East, Spain and Arizona (USA) is resistant to many of the commonly used insecticides for managing whiteflies, including the pyrethroids, neonicotinoids, pymetrozine and insect growth regulators. A resistance monitoring programme for the neonicotinoids in southern Florida (USA) has found that tolerance in biotype B has increased eight-fold on average from 2000 to 2006 for imidacloprid and about 15-fold from 2003 to 2006 for thiamethoxam - Platinum (Schuster et al., 2007). To reduce insecticide regimen and minimize the impact on environment and biodiversity, it was recommended to establish a 2-months crop-free period, to disturb the whitefly cycle by creating a time break between autumn and spring crops, to alternate insecticides, not to apply insecticides on weeds on field perimeters that could kill whitefly natural enemies and, thus, interfere with biological control (Schuster et al., 2007).

Social Impact

Tomato constitutes an important component of the diet in the countries surrounding the Mediterranean sea, Sub-Saharan Africa, Central and South-East Asia, the Caribbean Islands, Mexico and Central America. Many fields are small, family owned and managed by women and children. Tomato constitutes a substantial income for the growers. TYLCV threatens tomato production; usually infected fields do not produce and the entire crop may be lost. Spraying insecticides has been the method of choice to control the TYLCV whitefly vector, sometimes daily. This of course constitutes a financial burden, endangers the health of the farmers and contaminates the environment. Farmers borrow money to buy new seeds expecting a virus-free season. Often, the debts are so high that the fields are sold and the farmers emigrate to other countries, most of the time illegally. In some regions, tomato fields, and even tomato processing factories, have been totally abandoned (Central America, Sub-Saharan Africa).

Risk and Impact Factors

• Invasive in its native range
• Proved invasive outside its native range
• Has a broad native range
• Abundant in its native range
• Highly adaptable to different environments
• Has high genetic variability

• Ecosystem change/ habitat alteration
• Host damage
• Increases vulnerability to invasions
• Negatively impacts agriculture
• Negatively impacts cultural/traditional practices
• Negatively impacts human health
• Negatively impacts livelihoods
• Reduced native biodiversity
• Threat to/ loss of native species
• Damages animal/plant products
• Negatively impacts trade/international relations

• Pest and disease transmission
• Interaction with other invasive species

• Highly likely to be transported internationally accidentally
• Highly likely to be transported internationally deliberately
• Highly likely to be transported internationally illegally
• Difficult/costly to control

Diagnosis

Accurate diagnosis of TYLCV is best achieved using methods based on virus-specific DNA probes and PCR primers derived from the sequence of the viral genome. TYLCV can be detected in tissues of infected plants as well as in insect vectors. Monoclonal as well as polyclonal antibodies do not have such a level of specificity and may detect several begomoviruses.

1. Molecular DNA-DNA Hybridization

1.1. Southern blot hybridization

Plant DNA may be prepared according to the CTAB-based method (Taylor and Powell, 1982) and whitefly DNA is extracted with SDS-Proteinase K (Zeidan and Czosnek, 1991). DNA is subjected to agarose gel electrophoresis, blotted, pre-hybridized and hybridized with a virus-specific DNA probe as described (Ber et al., 1990). The probe may consist of the full-length viral genome or virus species-specific sequences such as the intergenic region. The probe is labelled either with a radioactive nucleotide (e.g. 32P-adCTP) or with a non-radioactive nucleotide (e.g. digoxygenin-11-dUTP). The blots are then washed at 65°C for 30 min (twice) in 150 mM NaCl and 15 mM trisodium citrate (1 x SSC). Washing the blot at 70°C in 0.1 x SSC allows discrimination between closely related TYLCV isolates, such as viruses from Israel and from Italy (Czosnek et al., 2001). If the probe is radiolabelled, the blot is exposed to an X-ray film. For non-radioactive probing, the blot is subjected to immunological detection. After blocking, the filter is incubated with an anti digoxygenin alkaline phosphatase conjugate (diluted 1:5000). After washing, the filter may be incubated with the alkaline phosphatase substrates Nitro Blue Tetrazolium (NBT) and 5-Bromo-4-chloro-3-indolyl phosphate (BCIP), until a dark blue colour is obtained. Alternatively the virus-probe complex can be detected by chemiluminescence (Caciagli and Bosco, 1996). Non-radioactive digoxygenin-labelled DNA probes can be almost as sensitive as radioactive probes.

1.2. Tissue print hybridization

TYLCV DNA sequences can be detected specifically and sensitively by hybridization of infected plant tissues squashed onto a nylon membrane (squash-blot) with a radiolabelled specific DNA probe (Navot et al., 1989). No treatment of the sample is necessary prior to squashing and hybridization. TYLCV DNA could be detected in squash-blots of tomato leaves, roots, stems, flowers and fruits. Viral sequences can also be detected in squashes of a single whitefly that has fed on infected tomato plants. An assay that can be used in the field for the detection of TYLCV has been developed (Zilberstein et al., 1989). Plant and insect tissue squashes are hybridized with sulfonated virus complementary (-) strand DNA produced from a full-length DNA clone using the M13K07 helper phage. A mouse monoclonal antibody binds to the sulfone groups of the DNA hybrid; this complex is recognized by a goat anti-mouse immunoglobulin antibody conjugated to alkaline phosphatase which enzyme transforms a colourless substrate into a coloured product, indicating the presence of viral nucleic acids. Virus can be detected in stems, leaves, roots, flowers and fruits. It can also be detected in the whitefly vector, at the individual level.

2. Polymerase Chain Reaction (PCR)

PCR is widely used for the diagnosis of geminiviral diseases, allowing the detection of very small amounts of the disease agent in the infected plant and vectors, and also the cloning of genomic fragments of the pathogen. The following cycling protocol can be used to amplify the full-length TYLCV genome or viral DNA fragments from infected plants (50 ng DNA) or from viruliferous whiteflies (10 ng): initial denaturation for 3 min at 95°C, annealing of primers (0.2 mM each) for 1 min at 55°C, extension for 2 min at 72°C, and denaturation for 1 min at 94°C; subsequent cycles are: 1 min at 55°C, 2 min at 72°C and 1 min at 94°C; after 30 cycles, the reaction is terminated by a 10 min incubation at 72°C (Navot et al., 1992). The PCR products are subjected to agarose gel electrophoresis, stained with ethidium bromide and photographed. The primers are deduced from the sequence of the virus genome. Amplification of the full-length TYLCV genome can be achieved using primers V41 (nucleotides 61-80, from 5' to 3': ATACTTGGACACCTAATGGC) and C60 (nucleotides 41-60: AAGTAAGACACCGATACACC). Specific primers can be designed to discriminate between TYLCV species, e.g. from Israel (TYLCV) and from Sardinia, Italy (TYLCSV). For example, the TYLCV primers V2325 (nt 2325-2350, 5'CGTAGGTCTTGACATCTGTTGAGCTC3') and C2714 (nt 2714-2690, 5'CAAATAGCCATTAGGTGTCCAAGTA3') allow amplification of a 385 bp DNA from TYLCV from Israel (but not from TYLCSV). Conversely, the TYLCSV primers VS2308 (nt 2308-2333 viral strand, 5'TATAGGA CTTGACGTCGGAGCTCGAT3') and CS2698 (nt 2698-2670, complementary strand, 5'GGGG GCATCATATATATTGCCCCCCAATT3') allowing amplification of a 390 bp DNA fragment of TYLSCV (but not from TYLCV) (Goldman and Czosnek, 2002). Multiplex PCR with virus-specific primers was used to detect TYLCV-IL, TYLCV-Mld and TYLCSV in tomato samples from Egypt, Israel, Jordan and Lebanon (Anfoka et al., 2008)

TYLCV DNA can be amplified by PCR using plant and insect tissues squashed on a membrane as a template (Atzmon et al., 1998; Navas-Castillo et al., 1998). Samples are used as is. They may be stored in a dry state for several weeks without using their capacity to serve as template for PCR. Practically, a strip of 1 x 2 mm containing the tissue print is cut and immersed into the 25 ml PCR mix contained in a vial before initiation of amplification. Cycling and analysis of products is as described above.

3. Rolling-circle amplification

The rolling circle mode of geminivirus replication can be used for their diagnosis (Jeske, 2007). TYLCV, like any other geminivirus, can be amplified from total DNA of infected plants using the bacteriophage phi29 DNA polymerase. The amplified viral DNA induced typical symptoms after biolistic inoculation of test plants. Infectious DNA was obtained successfully from fresh, freeze-dried or desiccated plant material, from squashes of plant leaves on FTA cards, as well as from the insect vector. Plant material collected and dried as long as 25 years ago yielded infectious DNA by this method (Guenoune-Gelbart et al., 2010).

4. Microarrays

Microarray-based platforms constitute a new tool in the ever challenging world of plant virus diagnosis. They have the potential to simultaneously detect a number of viruses in a single reaction. Oligonucleotides (40-70 nt-long) with sequences based on the viral genomes that are the object of potential diagnosis) are printed on a slide. In general the RNA or the DNA of the suspected plant is labelled with a fluorescent dye (during or after reverse transcription or PCR) and hybridized with the printed oligo targets on the slide array. The fluorescent spots are localized and the pathogen is identified (Boonham et al., 2007). This technology has been used to identify TYLCV in infected tomato plants (Tiberini et al., 2010).

5. Immunological Methods

5.1. ELISA

TYLCV can be detected by standard ELISA procedures; however, as for all immunological methods, the antibodies available are usually unable to distinguish TYLCV from closely-related begomoviruses, and unable to discriminate between TYLCV species and strains.

5.2. Dot immuno-binding assay (DIBA)

This detection procedure is a modification of that described by Hibi and Saito (1985). Sample preparation has been described by Poolpol (1986). The antiserum raised in rabbits against TYLCV is cross-absorbed with dried leaf powder of non-infected tomato tissue. One µl of crude sap obtained after crushing tissues from infected plants is spotted onto a nitrocellulose membrane. After blocking, the membrane is covered with the anti-TLYCV antibody, washed and incubated with alkaline phosphatase conjugated-goat anti-rabbit IgG, washed and incubated with the substrate solution (0.1% napthol AS-MX phosphate mixed with an equal volume of 6 mg/ml Fast Red TR salt in 0.2 M Tris-HCl, pH 8.2). The results are evaluated by colour development; a pink coloration on the sample spot is a positive reaction. The green colour of concentrated crude sap could interfere with the development of colour in a positive reaction.

5.3. Immune Electron Microscopy (IEM)

The trap-decoration method (Milne and Luisoni, 1977) can be used to detect TYLCV but it is not practical to use for the detection of the virus from large numbers of plant samples. Membrane-coated grids are floated on drops of 1:10 diluted antiserum, washed and floated on sap of infected plant. Washed grids are then floated on diluted (1:100) absorbed-antiserum to allow decoration of virus particles, washed and stained with 2% uranyl acetate. Virus particles are observed by transmission electron microscopy.

Detection and Inspection

Symptom severity depends on the date of inoculation, tomato variety and whitefly pressure. Typical symptoms include curling and yellowing of young leaves and severe stunting. TYLCV and the strain involved are best identified by sequencing either full-length clones or PCR-amplified genomic DNA fragments using specific primers. Squash blot hybridization with a virus-specific DNA probe, followed by high stringency washes, also allows discrimination between viruses and their strains (see Diagnosis).

Similarities to Other Species/Conditions

The DNA sequence of the genome (full-length or partial) of several tens of begomovirus species and strains infecting tomato available in public databases such as Genbank show that the many different begomoviruses that infect tomato are characterized by considerable genetic diversity. Some possess a monopartite genome (e.g. TYLCV, TYLCSV, TYLCCV, TLCV from southern India, Australia and Taiwan), while others have their genome split between two DNA molecules (e.g. TYLCTHV, TLCV from northern India, TGMV, TMoV, ToLCrV).

Nucleotide comparisons of the full-length genome or of selected areas (e.g. intergenic region, coat protein gene, Rep gene) have provided a glimpse into the phylogenetic relatedness of these viruses (Rybicki, 1994; Padidam et al., 1996; Nakhla and Maxwell, 1998; Brown et al., 2001; Abhary et al., 2007; Lefeuvre et al., 2010). Sequence comparisons of begomovirus genomes and open reading frames (ORF) has allowed these viruses to be grouped according to their geographical origin: 1) Middle East and Central Asia, 2) Western Mediterranean basin, 3) Indian subcontinent, 4) North and Sub-Saharan Africa, 5) East and South-East Asia and Australia, and 6) New World with subgroups including USA, Central and South America and the Caribbean Islands (except the newly introduced Middle Eastern TYLCV). Similarly, the whitefly Bemisia tabaci complex could be resolved into seven major groups on the basis of mitochondrial DNA markers, essentially overlapping the geographical distribution of begomoviruses (Brown, 2010; De Barro et al., 2011).

Based upon their sequence, TYLCV from Israel and from Egypt can be considered to be isolates of the same strain. The same is valid for TYLCV from Israel and from the Dominican Republic and Jamaica, indicating that TYLCV was recently introduced to the Caribbean from the Middle East. Similarly, the Sardinian and the Spanish isolates of TYLCV are almost identical and are therefore strains of the same species. On the other hand, the Italian and Israeli TYLCV isolates are different enough to be considered as two virus species. The Thai TYLCV isolate constitutes a separate species. The nucleotide sequence of TYLCTHV component B shows low homology with other bipartite begomoviruses (e.g. about 55% with TGMV and Squash leaf curl virus).

The geographically associated variation of tomato begomoviruses is best illustrated by the comparison of their coat protein (CP). Differences associated with geography are best exemplified when comparing the isolates from north and south Saudi Arabia, two regions separated by a large expanse of desert. Their capsid proteins share only 78% homology. The northern isolate is closely related to TYLCV from Israel (95% homology), while the southern isolate is not (81% homology). On the other hand, the Sicilian and Sardinian isolates of TYLCV are found on two islands separated by 300 km; nevertheless their capsid protein share 95% homology. In several cases, the coat protein of TYLCV is more homologous to the coat protein of other begomoviruses occurring in the same region than to TYLCV isolates from other regions. For example, the coat protein of TYLCV from Nigeria is more related to the local African cassava mosaic virus (ACMV) than to TYLCV from Thailand (80% vs. 76%), a fact that may point to adaptation of the geminivirus to its vector. Moreover, viruses in different geographical regions have different epitope profiles, whereas those from the same region have similar profiles (Macintosh et al., 1992). Differences in the sequence of the capsid protein may lead to differences in virus transmissibility by B. tabaci (McGrath and Harrison, 1995).

Prevention and Control

Cultural Control

Growing tomato in open fields is much more constraining than growing under cover. In all regions where TYLCV is endemic, seedlings need to be grown and kept in a glasshouse or a screenhouse in order to prevent early infection by whitefly feeding. In Thailand, farmers grow tomato plants in isolated paddy fields after rice harvesting. In Egypt the spread of TYLCV in open fields was successfully controlled by roguing infected plants and removing all overwintered tomato crops before the emergence of whitefly populations (Mazyad et al., 1986). Similar measures were undertaken in Cyprus over 3 consecutive years resulting in a decrease in the incidence of the disease from 50 to 5% (Ioannou, 1987). In the Dominican Republic, a mandatory 3 months host-free growing period which included bean, cucurbits, aubergine, melon, okra, pepper and tomato, significantly reduced the inoculum and lowered to a minimum the incidence of TYLCV (Gilbertson et al., 2007). Early planting when the incidence of B. tabaci is low, effectively reduced TYLCV infection in Egypt, Israel and Cyprus. Interplanting with rows of TYLCV non-host trap plants such as squash and cucumber have been used to divert whiteflies from tomato in the Jordan Valley, delaying TYLCV infection by 2 months (Al-Musa, 1982). Sticky yellow plastic polyethylene sheets have been used, with limited success, to decrease the pressure of the whitefly population (Cohen et al., 1974). When economically feasible, growing tomatoes in greenhouses covered with insect-proof 50-mesh screens and double-doors constitutes the optimal solution for crop protection against the TYLCV whitefly vector (Cohen and Berlinger, 1986; Ioannou, 1987). UV-absorbing plastic sheets or UV-absorbing 50-mesh screens, used as tunnels or as screenhouse covers, greatly reduced the infestation of tomato plants by B. tabaci and the incidence of TYLCV (Antignus et al., 1998). Whitefly natural enemies (Gerling, 1990) have not been used on a large scale in open fields.

Chemical Control

Applying systemic insecticides as soil drenches or regular spraying during the seedling stage can reduce the population of the B. tabaci vector and the incidence of TYLCV. Many insecticides such as organophosphates, carbamates and pyrethroids effectively reduce the whitefly population, whether sprayed one insecticide at a time, alternately, or together with oil and emulsifiers (Makkouk and Laterrot, 1983). However, these insecticides provided only partial TYLCV control, even when sprayed daily (Cohen and Antignus, 1994). Continued extensive use of insecticides is not only detrimental to the environment but it promotes the development of resistant whitefly populations (Cahill et al., 1995). More potent insecticides with novel modes of action such as imidacloprid were introduced in the 1990s (Elbert et al., 1990). Over the past few years imidacloprid has assumed major importance for control of B. tabaci in the field and in greenhouses. To be efficient, the insecticide has to induce the death of all whiteflies within 35-40 min before it succeeds in infecting the plant, thereby preventing inoculation of TYLCV, which is not always the case in the field (Rubinstein et al., 1999). As for other commonly used insecticides, whitefly populations resistant to imidacloprid have been emerging in many places (Castle et al., 2010).

Host-Plant Resistance

Breeding programmes aimed at producing tomato cultivars resistant to TYLCV started in the late 1960s and have expanded since. These programmes are based on the introgression into the domesticated tomato Solanum lycopersicum of resistance or tolerance found in some accessions of wild tomato species such as S. cheesmaniae, S. chilense, S. habrochaites, S. peruvianum and S. pimpinellifolium. Depending on the plant source, resistance was reported to be controlled by one to five loci, either recessive or dominant (Zakay et al., 1991; Picó et al., 1996; Nakhla and Maxwell, 1998). The first commercial tolerant cultivar, TY20 (Hazera) carrying tolerance from S. peruvianum, showed delayed symptoms and the accumulation of viral DNA (Pilowski and Cohen, 1990; Lapidot et al., 1997). More advanced cultivars derived from TY-20 include 8484 and 8472. Additional commercial hybrids tolerant to TYLCV include Anastasia (Brunsma), Silver, Beludo and Ulyses (Seminis), Fiona and Jackal (Sluis and Groot), TOP 21 (Clause), Saria and Gemstar (Petoseed), Hilario, Rex, Tycoon and Tyking, (Royal Sluis), Pitenza-TY and Pal-TY (Enza-Zaden). In heavily affected areas, these hybrids need to be protected with insecticides during the first weeks after planting to produce acceptable yields. Many experimental lines are being developed which show good levels of resistance against TYLCV and other begomoviruses affecting tomato worldwide. The breeding line TY172 originating from S. peruvianum is a symptomless carrier of TYLCV whether infected in the greenhouse or in the field; at least three loci may account for the resistance (Friedmann et al., 1998). The breeding line 902 originating from S. habrochaites support little virus accumulation; another line derived from the same wild tomato progenitor, line 908, is tolerant to the virus. Tolerance is controlled by a dominant major locus, and resistance by two to three additive recessive loci (Vidavski and Czosnek, 1998). Nine hybrids based on these lines have been successfully tested in infested fields in Israel, Egypt, Morocco and Guatemala.

Marker-assisted breeding has allowed localization of TYLCV-resistance loci on the tomato genetic map and has been instrumental in developing new tomato varieties. Using polymorphic DNA markers, a TYLCV-tolerance gene originating from S. chilense LA1969, Ty-1, has been mapped to tomato chromosome 6, close to the nematode resistance Mi gene (Zamir et al., 1994). Another locus associated with tolerance originating from S. pimpinellifolium has been mapped to chromosome 6 but to a locus different from Ty-1 (Chague et al., 1997). Polymorphic markers have also been used to map a loci coinded Ty-2 conferring resistance to ToLCV, originating from S. habrochaites to tomato chromosome 11 (Hanson et al., 2000). A major partially dominant locus, termed Ty-3, was mapped to chromosome 6, near the Ty-1 locus (Ji et al., 2007). Another TYLCV resistance locus, termed Ty-4, was mapped on the long arm of Chromosome 3 (Ji et al., 2008). Another locus, termed Ty-5, was mapped to chromosome 4 using the breeding highly resistant line TY172, which originating from S. peruvianum (Anbinder et al., 2009). The different sources of resistance were piled up to provide tomato plants with better resistance to TYLCV (Vidavski et al., 2008). The genes conferring resistance have not yet been isolated. An RNAi-based genome-wide screening is under way to uncover the gene network sustaining TYLCV resistance in tomato lines issued from S. habrochaites (Czosnek et al., 2011b).

Genetic Engineering

1. Pathogen-derived resistance

Virus-resistant transgenics have been developed in many crops by introducing either viral capsid protein or replicase gene encoding sequences. This concept has been called pathogen-derived resistance (PDR) (Lomonossoff, 1995; Baulcombe, 1996). PDR has been the most common approach used to obtain resistance to TYLCV, including viral sequences that generate antisense RNA as well as the expression of full-length and truncated viral genes (Polston and Hiebert, 2007). The CP gene was one of the first TYLCV genes evaluated for the ability to generate pathogen-derived resistance. Tomato plants expressing the TYLCV CP showed a delay in symptoms, a recovery from infection, and resistance upon repeated inoculations (Kunik et al., 1994). Expression antisense RNA of the TYLCSV Rep gene provided a good level of resistance in Nicotiana benthamiana (Bendahmane and Gronenborn, 1997). The expression of sense and antisense constructs of truncated TYLCSV Rep in N. benthamiana also showed resistance (Noris et al., 1996). When a truncated TYLCV-Mld Rep gene was expressed in tomato, the transgenic plants were resistant to TYLCV-Mld, but were susceptible to TYLCV-IL (Antignus et al., 2004). A 2/5 TYLCV Rep gene construct conferred high levels of resistance and often immunity in both transformed N. tabacum and S. lycopersicum (Yang et al., 2004).

2. Virus gene silencing

 Viruses trigger plant antiviral mechanisms leading to the degradation of viral RNA via the formation of dsRNA derived from viral sequences, initiating post-transcriptional gene silencing (PTGS). This phenomenom was named RNA-mediated gene silencing. Some viruses establish themselves by expressing silencing supressor genes, which interfere with plant host silencing mechanisms (Voinnet et al., 1999; Roth et al., 2004). RNA-mediated virus resistance proved to be more efficient than protein-mediated resistance but was highly-sequence dependent. Transgenic plants have been developed which exploited the mechanism of silencing via dsRNA (Smith et al., 2000). Using a transformation cassette consisting of the 3’-end of the Rep (sense and antisense orientation) as the arms of the hairpin, and a castor bean catalase as the intron, the treated tomato plants showed immunity to TYLCV upon whitefly-mediated inoculation (Fuentes et al., 2006). A similar approach was used with the 5’-end of the TYLCV CP gene and a maize ubiquitin intron, inducing resistance to TYLCV in tomato (Zrachya et al., 2007). The intron-hairpin approach was used to express multiple TYLCV sequences in tobacco and tomato plants (Abhary et al., 2006). The treated plants were symptomless and TYLCV DNA was not detected. In general, silencing was specific to the TYLCV strain; silencing using TYLCV sequences conferred resistance to TYLCV but not to other TYLCV species or strains, such as TYLCSV (Noris et al., 2004).

3. GroEL

This novel approach is based on the observation that GroEL produced by whitefly endosymbiotic bacteria binds to the CP of TYLCV in the insect hemolymph, thereby protecting the virion from destruction and ensuring transmission (Morin et al., 1999). TYLCV-GroEL binding has been exploited to generate TYLCV resistant tomato plants. Tomatoes transformed with GroEL under a phloem-specific promoter showed milder to no symptoms in plants in the R₀ through R₂ generation. GroEL/TYLCV complexes were readily detected in resistant plants. It was hypothesized that GroEL/TYLCV complexes formed in transformed plants and that these complexes were interfering in virus movement (Akad et al., 2007).

References

Abhary M, Patil BL, Fauquet CM, 2007. Molecular biodiversity, taxonomy and nomenclature of tomato yellow leaf curl-like viruses. In: The Tomato Yellow Leaf Curl Virus Disease: Management, Molecular Biology, Breeding for Resistance [ed. by Czosnek, H.]. Dordrecht, The Netherlands: Springer, 85-121.

Abhary MK, Anfoka GH, Nakhla MK, Maxwell DP, 2006. Post-transcriptional gene silencing in controlling viruses of the Tomato yellow leaf curl virus complex. Archives of Virology, 151(12):2349-2363. http://springerlink.metapress.com/content/h2104u3425h17702/?p=141cd8d29a3648b78892c3387dcfde62&pi=2

Abou-Jawdah Y, Maalouf R, Shebaro W, Soubra K, 1999. Comparison of the reaction of tomato lines to infection by tomato yellow leaf curl begomovirus in Lebanon. Plant Pathology, 48(6):727-734; 17 ref.

Afouda LAC, Kotchofa R, Sare R, Zinsou V, Winter S, 2013. Occurrence and distribution of viruses infecting tomato and pepper in Alibori in northern Benin. Phytoparasitica, 41(3):271-276. http://rd.springer.com/article/10.1007/s12600-013-0287-z

Akad F, Dotan N, Czosnek H, 2004. Trapping of Tomato yellow leaf curl virus (TYLCV) and other plant viruses with a GroEL homologue from the whitefly Bemisia tabaci. Archives of Virology, 149(8):1481-1497.

Akad F, Eybishtz A, Edelbaum D, Gorovits R, Dar-Issa O, Iraki N, Czosnek H, 2007. Making a friend from a foe: expressing a GroEL gene from the whitefly Bemisia tabaci in the phloem of tomato plants confers resistance to tomato yellow leaf curl virus. Archives of Virology, 152(7):1323-1339. http://springerlink.metapress.com/content/kv6r8815488h7l06/?p=7b517d55c5b5459e9856e76b34dbd89a&pi=8

Al-Ali E, Al-Hashash H, Heji AB, Al-Aqeel H, 2016. First report of Tomato yellow leaf curl virus infecting cucumber in Kuwait. Plant Disease, 100(3):656. http://apsjournals.apsnet.org/loi/pdis

Al-Musa A, 1982. Incidence, economic importance, and control of tomato yellow leaf curl in Jordan. Plant Disease, 66(7):561-563

Alvarez PA, Abud-Ant·n AJ, 1995. Reporte de Rep·blica Dominicana. Honduras: CEIBA, 36:39-47.

Anbinder I, Reuveni M, Azari R, Paran I, Nahon S, Shlomo H, Chen L, Lapidot M, Levin I, 2009. Molecular dissection of Tomato leaf curl virus resistance in tomato line TY172 derived from Solanum peruvianum. TAG Theoretical and Applied Genetics, 119(3):519-530. http://www.springerlink.com/content/p2gv432802065147/?p=982365cb99dd433ca573a3a6163d3533&pi=11

Anfoka G, Abhary M, Ahmad FH, Hussein AF, Rezk A, Akad F, Abou-Jawdah Y, Lapidot M, Vidavski F, Nakhla MK, Sobh H, Atamian H, Cohen L, Sobol I, Mazyad H, Maxwell DP, Czosnek H, 2008. Survey of Tomato yellow leaf curl disease-associated viruses in the eastern Mediterranean basin. Journal of Plant Pathology, 90(2):313-322. http://www.sipav.org/main/jpp/

Antignus EY, Cohen S, 1994. Cloning of tomato yellow leaf curl virus (TYLCV) and the complete nucleotide sequence of a mild infectious clone. Phytopathology, 84:707-712.

Antignus Y, Lapidot M, Hadar D, Messika Y, Cohen S, 1998. Ultraviolet-absorbing screens serve as optical barriers to protect crops from virus and insect pests. Journal of Economic Entomology, 91(6):1401-1405; 8 ref.

Antignus Y, Vunsh R, Lachman O, Pearlsman M, Maslenin L, Hananya U, Rosner A, 2004. Truncated Rep gene originated from tomato yellow leaf curl virus-Israel [Mild] confers strain-specific resistance in transgenic tomato. Annals of Applied Biology, 144(1):39-44.

Ascencio-Ibßnez JT, Diaz-Plaza R, MTndez-Lozano J, Monsalve-Fonnegra ZI, Argnello-Astorga GR, Rivera-Bustamante RF, 1999. First report of tomato yellow leaf curl geminivirus in Yucatßn, MTxico. Plant Disease, 83(12):1178; 1 ref.

Attathom S, Chiemsombat P, Kositratana W, SaeUng N, 1994. Complete nucleotide sequence and genome analysis of bipartite tomato yellow leaf curl virus in Thailand. Kasetsart Journal, Natural Sciences, 28(4):632-639; 17 ref.

Atzmon G, van Hoss H, Czosnek H, 1998. PCR-amplification of tomato yellow leaf curl virus (TYLCV) from squashes of plants and insect vectors: application to the study of TYLCV acquisition and transmission. European Journal of Plant Pathology, 104:189-194.

Avgelis AD, Roditakis N, Dovas CI, Katis NI, Varveri C, Vassilakos N, Bem F, 2001. First report of Tomato yellow leaf curl virus on tomato crops in Greece. Plant Disease, 85(6):678; 2 ref.

Azam KM, Razvi SA, Al-Muhthuri MH, Al-Raeesi AA, 1997. Distribution pattern of sweet potato whitefly Bemisia tabaci (Gennadius) on tomato plants. Sultan Qaboos University Journal for Scientific Research - Agricultural Sciences, 2:43-50; 16 ref.

Bacci L, Crespo ALB, Galvan TL, Pereira EJG, Picanço MC, Silva GA, Chediak M, 2007. Toxicity of insecticides to the sweetpotato whitefly (Hemiptera: Aleyrodidae) and its natural enemies. Pest Management Science, 63(7):699-706. http://www.interscience.wiley.com/pestmanagementscience

Bananej K, Kheyr-Pour A, Ahoonmanesh A, Gronenborn B, 1998. DNA sequence of TYLCV from Iran. GenBank accession AJ132711.

Bañuelos-Hernández B, Mauricio-Castillo JA, Cardenas-Conejo Y, Guevara-González RG, Arguello-Astorga GR, 2012. A new strain of tomato severe leaf curl virus and a unique variant of tomato yellow leaf curl virus from Mexico. Archives of Virology, 157(9):1835-1841. http://www.springerlink.com/content/0718434534k026q6/

Barboza N, Blanco-Meneses M, Hallwass M, Moriones E, Inoue-Nagata AK, 2014. First report of Tomato yellow leaf curl virus in tomato in Costa Rica. Plant Disease, 98(5):699. http://apsjournals.apsnet.org/loi/pdis

Barro PJde, Liu ShuSheng, Boykin LM, Dinsdale AB, 2011. Bemisia tabaci: a statement of species status. Annual Review of Entomology, 56:1-19. http://www.annualreviews.org/doi/abs/10.1146/annurev-ento-112408-085504

Baulcombe DC, 1996. Mechanisms of pathogen-derived resistance to viruses in transgenic plants. Plant Cell, 8(10):1833-1844.

Bedford ID, Briddon RW, Jones P, Alkaff N, Markham PG, 1994. Differentiation of three whitefly-transmitted geminiviruses from the Republic of Yemen. European Journal of Plant Pathology, 100(3-4):243-257.

Bendahmane M, Gronenborn B, 1997. Engineering resistance against tomato yellow leaf curl virus (TYLCV) using antisense RNA. Plant Molecular Biology, 33(2):351-357.

Ber R, Navot N, Zamir D, Antignus Y, Cohen S, Czosnek H, 1990. Infection of tomato by the tomato yellow leaf curl virus: susceptibility to infection, symptom development, and accumulation of viral DNA. Archives of Virology, 112(3-4):169-180

Bird J, Idris AM, Rogan D, Brown JK, 2001. Introduction of the exotic Tomato yellow leaf curl virus-Israel in tomato to Puerto Rico. Plant Disease, 85(9):1028; 2 ref.

Boonham N, Tomlinson J, Mumford R, 2007. Microarrays for rapid identification of plant viruses. Annual Review of Phytopathology, 45:307-328. http://www.annualreviews.org

Brown JK, 2010. Phylogenetic biology of the Bemisia tabaci sibling species group. In: Bemisia, Bionomics and Management of a Global Pest [ed. by Stansly, P. A. \Naranjo, S. E.]. Dordrecht, Heidelberg, London, New York, Netherlands, Germany, UK, USA: Springer, 31-67.

Brown JK, Idris AM, 2006. Introduction of the exotic monopartite Tomato yellow leaf curl virus into West Coast Mexico. Plant Disease, 90(10):1360. HTTP://www.apsnet.org

Brown JK, Idris AM, Torres-Jerez I, Banks GK, Wyatt SD, 2001. The core region of the coat protein gene is highly useful for establishing the provisional identification and classification of begomoviruses. Archives of Virology, 146(8):1581-1598; 24 ref.

Brunschot SLvan, Persley DM, Geering ADW, Campbell PR, Thomas JE, 2010. Tomato yellow leaf curl virus in Australia: distribution, detection and discovery of naturally occurring defective DNA molecules. Australasian Plant Pathology, 39(5):412-423. http://www.publish.csiro.au/nid/39.htm

CABI/EPPO, 1998. Distribution maps of quarantine pests for Europe (edited by Smith IM, Charles LMF). Wallingford, UK: CAB International, xviii + 768 pp.

Caciagli P, 2007. Survival of whiteflies during long-distance transportation of agricultural products and plants. In: The Tomato Yellow Leaf Curl Virus Disease: Management, Molecular Biology, Breeding for Resistance [ed. by Czosnek, H.]. Dordrecht, The Netherlands: Springer, 57-63.

Caciagli P, Bosco D, 1996. Quantitative determination of tomato yellow leaf curl geminivirus DNA by chemiluminescent assay using digoxygenin-labeled probes. Journal of Virological Methods, 57:19-29.

Caciagli P, Bosco D, Al-Bitar L, 1995. Relationships of the Sardinian isolate of tomato yellow leaf curl geminivirus with its whitefly vector Bemisia tabaci Gen. European Journal of Plant Pathology, 101(2):163-170

Cahill M, Byrne FJ, Gorman K, Denholm I, Devonshire AL, 1995. Pyrethroid and organophosphate resistance in the tobacco whitefly Bemisia tabaci (Homoptera: Aleyrodidae). Bulletin of Entomological Research, 85(2):181-187.

Cai JianHe, Zhou XingHua, Huang FuXin, Qin BiXia, Wei XuePing, Lin BeiSen, Chen YongHui, 2009. Incidence related factors and integrated control of tobacco virus diseases in Guangxi. Guangxi Agricultural Sciences, 40(2):159-163. http://www.gxaas.net

Calixto M, Vazques LL, Mateo A, 1995. Reporte de Cuba. Honduras: CEIBA, 36:7-8.

Cardenas-Conejo Y, Arguello-Astorga G, Poghosyan A, Hernandez-Gonzalez J, Lebsky V, Holguin-Peña J, Medina-Hernandez D, Vega-Peña S, 2010. First report of Tomato yellow leaf curl virus co-infecting pepper with Tomato chino La Paz virus in Baja California Sur, Mexico. Plant Disease, 94(10):1266-1267. http://apsjournals.apsnet.org/loi/pdis

Castle SJ, Palumbo JC, Prabhaker N, Horowitz R, Delholm I, 2010. Ecological determinants of Bemisia tabaci resistance to insecticides. In: Bemisia: Biomics and Management of a Global Pest [ed. by Stansly, P. A. \Naranjo, S. E.]. Dordrecht, Heidelberg, London, New York, The Netherlands, Germany, UK, USA: Springer, 423-465.

Castro APde, Julián O, Díez MJ, 2013. Genetic control and mapping of Solanum chilense LA1932, LA1960 and LA1971-derived resistance to tomato yellow leaf curl disease. Euphytica, 190(2):203-214. http://rd.springer.com/journal/10681

ChaguT V, Mercier JC, GuTnard M, Courcel Ade, Vedel F, 1997. Identification of RAPD markers linked to a locus involved in quantitative resistance to TYLCV in tomato by bulked segregant analysis. Theoretical and Applied Genetics, 95(4):671-677; 38 ref.

Cherif C, Russo M, 1983. Cytological evidence of the association of a geminivirus with the tomato yellow leaf curl disease in Tunisia. Phytopathologische Zeitschrift, 108(3/4):221-225

Chiang BT, Nakhla MK, Maxwell DP, Schoenfelder M, Green SK, 1997. A new geminivirus associated with a leaf curl disease of tomato in Tanzania. Plant Disease, 81(1):111; 1 ref.

Chiemsombat P, Attathom S, Kositratana W, Sutabutra T, Sae-Ung N, 1992. Cloning of PCR-amplified coat protein gene of tomato yellow leaf curl virus. Kasetsart Journal (Natural Science Supplement), 26:1-5.

Chiemsombat P, Ikegami M, Attathom S, 1991. Serological relationship between tomato yellow leaf curl virus, mungbean yellow mosaic virus and tobacco leaf curl virus. Kasetsart Journal (Nat.Sci.Suppl.), 25:45-47.

Chinnaraja, C., Ramsubhag, A., Jayaraj, J., 2017. Identification of Tomato yellow leaf curl virus infecting cowpea in Trinidad., 101(10), 1830. http://apsjournals.apsnet.org/loi/pdis doi: 10.1094/pdis-05-17-0620-pdn

Chouchane SG, Gorsane F, Nakhla MK, Maxwell DP, Marrakchi M, Fakhfakh H, 2006. Complete nucleotide sequence and construction of an infectious clone of a Tunisian isolate of Tomato yellow leaf curl Sardinia virus. Journal of Phytopathology, 154(10):626-631. http://www.blackwell-synergy.com/servlet/useragent?func=showIssues&code=jph

Chouchane SG, Gorsane F, Nakhla MK, Maxwell DP, Marrakchi M, Fakhfakh H, 2007. First report of tomato yellow leaf curl virus-Israel species infecting tomato, pepper and bean in Tunisia. Journal of Phytopathology, 155(4):236-240. http://www.blackwell-synergy.com/loi/jph

Cohen J, Gera A, Ecker R, Ben-Joseph R, Perlsman M, Gokkes M, Lachman O, Antignus Y, 1995. Lisianthus leaf curl a new disease of lisianthus caused by tomato yellow leaf curl virus. Plant Disease, 79(4):416-420

Cohen S, 1990. Epidemiology of whitefly-transmitted viruses. In Gerling D, ed. Whiteflies: Their Bionomics, Pest status and Management. Andover, UK: Intercept Ltd., 211-225.

Cohen S, Antignus Y, 1994. Tomato yellow leaf curl virus, a whitefly-borne geminivirus of tomatoes. Advances in Disease Vector Research, 10:259-288

Cohen S, Berlinger MJ, 1986. Transmission and cultural control of whitefly-borne viruses. Agriculture, Ecosystems and Environment, 17(1/2):89-97

Cohen S, Harpaz I, 1964. Periodic, rather than continual acquisition of a new tomato virus by its vector, the tobacco whitefly (Bemisia tabaci Gennadius). Entomologia Experimentalis et Applicata, 7:155-166.

Cohen S, Kern J, Harpaz I, Ben-Joseph R, 1988. Epidemiological studies of the tomato yellow leaf curl virus (TYLCV) in the Jordan Valley, Israel. Phytoparasitica, 16(3):259-270.

Cohen S, Melamed-Madjar V, Hameiri J, 1974. Prevention of the spread of tomato yellow leaf curl virus transmitted by Bemisia tabaci (Gennadius) (Homoptera, Aleyrodidae) in Israel. Bulletin of Entomological Research, 64(2):193-197

Cohen S, Nitzany FE, 1966. Transmission and host range of the tomato leaf curl virus. Phytopathology, 56:1127-1131.

Credi R, Betti L, Canova A, 1989. Association of a geminivirus with a severe disease of tomato in Sicily. Phytopathologia Mediterranea, 28:223-226.

Crespi S, Noris E, Vaira AM, Accotto GP, 1995. Molecular characterization of cloned DNA from a tomato yellow leaf curl virus isolate from Sicily. Phytopathologia Mediterranea, 34(2):93-99

Culotta E, 1991. "Superbug" attacks California crops. Science, 254:1445.

Czosnek H, 2007. Interactions of Tomato yellow leaf curl virus with its insect vector. In: The Tomato Yellow Leaf Curl Virus Disease: Management, Molecular Biology, Breeding for Resistance [ed. by Czosnek, H.]. Dordrecht, The Netherlands: Springer, 157-170.

Czosnek H, 2007. Tomato Yellow Leaf Curl Virus Disease: Management, molecular biology, breeding for resistance. Dordrecht, The Netherlands: Springer, 420 pp.

Czosnek H, 2008. Tomato yellow leaf curl virus (geminiviridae). In: Encyclopedia of Virology. Third Edition [ed. by Mahy, B. W. J. \Regenmortel, M. H. V. van]. Amsterdam, The Netherlands: Elsevier, 138-145.

Czosnek H, 2010. Management of Tomato yellow leaf curl disease; a case study for emerging geminiviral diseases. In: Emerging Geminiviral Diseases and their Management [ed. by Sharma, P. \Gaur, R. K. \Ikegami, M.]. New York, USA: Nova Science Publishers Inc., 37-57.

Czosnek H, Ber R, Antignus Y, Cohen S, Navot N, Zamir D, 1988. Isolation of tomato yellow leaf curl virus, a geminivirus. Phytopathology, 78(5):508-512

Czosnek H, Ghanim M, Rubinstein G, Morin S, Fridman V, Zeidan M, 2001. Whiteflies: vectors - or victims ? - of geminiviruses. In: Maramorosch K, ed. Advances in Virus research, Academic Press, 57:291-322.

Czosnek H, Laterrot H, 1997. A worldwide survey of tomato yellow leaf curl viruses. Archives of Virology, 142(7):1391-1406; 67 ref.

Czosnek H, Sade D, Gorovits R, Vidavski F, Beeri H, Sobol I, Eybishtz E, 2011. A RNAi-based genome-wide screen to discover genes involved in resistance to Tomato yellow leaf curl virus (TYLCV) in tomato. In: RNAi Technology [ed. by Gaur, R. K. \Gafni, Y. \Sharma, P. \Gupta, V. K.]. New York, USA: Nova Science Publishers Inc., 155-176.

Dai FM, Zeng R, Chen WJ, Lu JP, 2011. First report of Tomato yellow leaf curl virus infecting cowpea in China. Plant Disease, 95(3):362. http://apsjournals.apsnet.org/loi/pdis

Dalmon A, Cailly M, David C, 2000. Comparison of serological and molecular techniques for detection of Tomato yellow leaf curl begomovirus. EPPO Conference on diagnostic techniques for plant pests, Waddington, The Netherlands, February 2000.

Delatte H, 2005. Study of the pathosystem Begomovirus/Bemisia tabaci/tomato on the South West islands of the Indian Ocean. Wageningen, Netherlands: Wageningen Universiteit (Wageningen University), 160 pp.

Delatte H, David P, Granier M, Lett JM, Goldbach R, Peterschmitt M, Reynaud B, 2006. Microsatellites reveal extensive geographical, ecological and genetic contacts between invasive and indigenous whitefly biotypes in an insular environment. Genetical Research, 87(2):109-124. http://journals.cambridge.org/action/displayJournal?jid=GRH

Delatte H, Lett J-M, Lefeuvre P, Reynaud B, Peterschmitt M, 2007. An insular environment before and after TYLCV introduction. In: The Tomato Yellow Leaf Curl Virus Disease: Management, Molecular Biology, Breeding for Resistance [ed. by Czosnek, H.]. Dordrecht, The Netherlands: Springer, 13-23.

D'Hondt MD, Russo M, 1985. Tomato yellow leaf curl in Senegal. Phytopathologische Zeitschrift, 112(2):153-160

Díaz-Pendón JA, Cañizares MC, Moriones E, Bejarano ER, Czosnek H, Navas-Castillo J, 2010. Tomato yellow leaf curl viruses: ménage à trois between the virus complex, the plant and the whitefly vector. Molecular Plant Pathology, 11(4):441-450. http://www.blackwell-synergy.com/loi/mpp

Ding M, Yue N, Zhang ZK, Zhao ZW, 2008. First report of Tomato yellow leaf curl virus in Artemisia annua in China. Journal of Plant Pathology, 90(3):589. http://www.sipav.org/main/jpp/

Duffy S, Holmes EC, 2007. Multiple introductions of the Old World begomovirus Tomato yellow leaf curl virus into the New World. Applied and Environmental Microbiology, 73(21):7114-7117. http://aem.asm.org

EFSA Panel on Plant Health, 2013. Scientific Opinion on the risks to plant health posed by Bemisia tabaci species complex and viruses it transmits for the EU territory. EFSA Journal, 11(4). 3162. http://www.efsa.europa.eu/sites/default/files/scientific_output/files/main_documents/3162.pdf

Elbert A, Overbeck H, Iwaya K, Tsuboi S, 1990. Imidacloprid, a novel systemic nitromethylene analogue insecticide for crop protection. Brighton Crop Protection Conference, Pests and Diseases - 1990. Vol. 1 Thornton Heath, UK; British Crop Protection Council, 21-28

El-Mehrach K, Sedegui M, Hatimi A, Tahrouch S, Arifi A, Czosnek H, Nakhla MK, Maxwell DP, 2007. Molecular characterization of a Moroccan isolate of Tomato yellow leaf curl Sardinia virus and differentiation of the Tomato yellow leaf curl virus complex by the polymerase chain reaction. Phytopathologia Mediterranea, 46(2):185-194. http://epress.unifi.it/riviste

EPPO, 2014. PQR database. Paris, France: European and Mediterranean Plant Protection Organization. http://www.eppo.int/DATABASES/pqr/pqr.htm

European Whitefly Study Network Newsletter, 2001. Evaluating AGRI-50 against Bemisia tabaci in the Souss Valley of Morocco - a new non-toxic pesticide. Issue N0. 11, September 2001.

Fauquet CM, Maxwell DP, Gronenborn B, Stanley J, 2000. Revised proposal for naming geminiviruses. Archives of Virology, 145(8):1743-1761; 11 ref.

Font I, Martfnez-Culebras P, Jordß C, 2000. First report of tomato yellow leaf curl virus-Is (TYLCV-Is) in the Canary Islands. Plant Disease, 84(9):1046; 3 ref.

Friedmann M, Lapidot M, Cohen S, Pilowsky M, 1998. A novel source of resistance to tomato yellow leaf curl virus exhibiting a symptomless reaction to viral infection. Journal of the American Society for Horticultural Science, 123(6):1004-1007; 16 ref.

Frohlich D, Torres-Jerez I, Bedford ID, Markham PG, Brown JK, 1999. A phylogenetic analysis of the Bemisia tabaci species complex based on mitochondrial DNA markers. Molecular Ecology, 8:1593-1602.

Fuentes A, Ramos PL, Fiallo E, Callard D, Sánchez Y, Peral R, Rodríguez R, Pujol M, 2006. Intron-hairpin RNA derived from replication associated protein C1 gene confers immunity to Tomato Yellow Leaf Curl Virus infection in transgenic tomato plants. Transgenic Research, 15(3):291-304. http://springerlink.metapress.com/link.asp?id=100225

Gallitelli D, Luisoni E, Martinelli GP, Caciagli P, Milne RG, Accotto GP, Antignus Y, 1991. Tomato yellow leaf curl disease in Sardinia. Informatore Fitopatologico, 41(7-8):42-46

Gerling D, 1990. Natural enemies of whiteflies: predators and parasitoids. In: Gerling D, ed. Whiteflies: Their Bionomics, Pest Status and Management. UK: Intercept Ltd., 147-185.

Ghanim M, Morin S, Zeidan M, Czosnek H, 1998. Evidence for transovarial transmission of tomato yellow leaf curl virus by its vector, the whitefly Bemisia tabaci. Virology (New York), 240(2):295-303; 40 ref.

Gilbertson RL, Rojas MR, Kon T, Jaquez J, 2007. Introduction of Tomato yellow leaf curl virus into the Dominican Republic: the development of a successful integrated pest management strategy. In: The Tomato Yellow Leaf Curl Virus Disease: Management, Molecular Biology, Breeding for Resistance [ed. by Czosnek, H.]. Dordrecht, The Netherlands: Springer, 283-307.

Goldman V, Czosnek H, 2002. Whiteflies (Bemisia tabaci) issued from eggs bombarded with infectious DNA clones of Tomato yellow leaf curl virus from Israel (TYLCV) are able to infect tomato plants. Archives of Virology, 147(4):787-801; 25 ref.

Green SK, Tsai WS, Shih SL, Black LL, Rezaian A, Rashid MH, Roff MMN, Myint YY, Hong LTA, 2001. Molecular characterization of begomoviruses associated with leafcurl diseases of tomato in Bangladesh, Laos, Malaysia, Myanmar, and Vietnam. Plant Disease, 85(12):1286.

Griffiths PD, Scott JW, 2001. Inheritance and linkage of tomato mottle virus resistance genes derived from Lycopersicon chilense accession LA 1932. Journal of the American Society for Horticultural Science, 126(4):462-467; 30 ref.

Guenoune-Gelbart D, Sufrin-Ringwald T, Capobianco H, Gaba V, Polston JE, Lapidot M, 2010. Inoculation of plants with begomoviruses by particle bombardment without cloning: using rolling circle amplification of total DNA from infected plants and whiteflies. Journal of Virological Methods, 168(1/2):87-93. http://www.sciencedirect.com/science/journal/01660934

Hajimorad MR, Kheyr-Pour A, Alavi V, Ahoonmanesh A, Bahar M, Rezaian MA, Gronenborn B, 1996. Identification of whitefly transmitted tomato yellow leaf curl geminivirus from Iran and a survey of its distribution with molecular probes. Plant Pathology, 45(3):418-425; 25 ref.

Hanson PM, Bernacchi D, Green S, Tanksley SD, Venkataramappa Muniyappa, Padmaja AS, Chen HueiMei, Kuo G, Fang D, Chen JenTzu, 2000. Mapping a wild tomato introgression associated with tomato yellow leaf curl virus resistance in a cultivated tomato line. Journal of the American Society for Horticultural Science, 125(1):15-20; 34 ref.

Hibi T, Saito Y, 1985. A dot immunobinding assy for the detection of tobacco mosaic virus in infected tissues. Journal of General Virology, 66:1191-1194.

Hong YG, Harrison BD, 1995. Nucleotide sequences from tomato leaf curl viruses from different countries: evidence for three geographically separate branches in evolution of the coat protein of whitefly-transmitted geminiviruses. Journal of General Virology, 76(8):2043-2049; 33 ref.

Idris AM, Brown JK, 2005. Evidence for interspecific-recombination for three monopartite begomoviral genomes associated with the tomato leaf curl disease from central Sudan. Archives of Virology, 150(5):1003-1012. http://springerlink.metapress.com/link.asp?id=100423

Idris AM, Guerrero JC, Brown JK, 2007. Two distinct isolates of Tomato yellow leaf curl virus threaten tomato production in Arizona and Sonora, Mexico. Plant Disease, 91(7):910. HTTP://www.apsnet.org

Ingram DM, Henn A, 2001. First report of tomato yellow leaf curl virus in Mississippi. Plant Disease, 85(12):1287; 3 ref.

Ioannou N, 1985. Yield losses and resistance of tomato to strains of tomato yellow leaf curl and tobacco mosaic viruses. Technical Bulletin, Agricultural Research Institute, Cyprus, No.66:11 pp.

Ioannou N, 1987. Cultural management of tomato yellow leaf curl disease in Cyprus. Plant Pathology, 36(3):367-373

Jeske H, 2007. Replication of geminiviruses and the use of rolling circle amplification for their diagnosis. In: The Tomato Yellow Leaf Curl Virus Disease: Management, Molecular Biology, Breeding for Resistance [ed. by Czosnek, H.]. Dordrecht, The Netherlands: Springer, 145-160.

Ji Y, Scott JW, Maxwell DP, Schuster DJ, 2008. Ty-4, a tomato yellow leaf curl virus resistance gene on chromosome 3 of tomato. Tomato Genetic Cooperative Reports, 58:29-31.

Ji YF, Schuster DJ, Scott JW, 2007. Ty-3, a begomovirus resistance locus near the Tomato yellow leaf curl virus resistance locus Ty-1 on chromosome 6 of tomato. Molecular Breeding, 20(3):271-284. http://www.springerlink.com/link.asp?id=100317

Ji YH, Zhang H, Zhang K, Li G, Lian S, Cheng ZB, Zhou YJ, 2013. First report of Tomato yellow leaf curl virus in Acalypha australis in China. Plant Disease, 97(3):430-431. http://apsjournals.apsnet.org/loi/pdis

Jupin I, Kouchkovsky F de, Jouanneau F, Gronenborn B, 1994. Movement of tomato yellow leaf curl geminivirus (TYLCV): involvement of the protein encoded by ORF C4. Virology (New York), 204(1):82-90

Kahan RP, 1982. The host as a vector: Exclusion as a control. In: Pathogens, vectors, and plant diseases: Approaches to control [ed. by Harris, K. F. \Maramorosch, K.]. New York, USA: Academic Press Inc., 123-149.

Kahan RP, 1982. The host as a vector: Exclusion as a control. In: Pathogens, vectors, and plant diseases: Approaches to control [ed. by Harris, K. F. \Maramorosch, K.]. New York, USA: Academic Press, 123-149.

Kashina BD, Mabagala RB, Mpunami AA, 2007. Serological detection and variability of Tomato yellow leaf curl virus isolates from Tanzania. Journal of Plant Protection Research, 47(4):367-373. http://www.ior.poznan.pl/Journal/

Kato K, Onuki M, Fuji S, Hanada K, 1998. The first occurrence of tomato yellow leaf curl virus in tomato (Lycopersicon esculentum Mill.) in Japan. Annals of the Phytopathological Society of Japan, 64(6):552-559; 34 ref.

Kerkadi M, Belkhoda F, Ait Ouada M, 1998. Identification test of Tomato yellow leaf curl virus on tomato and green pepper in Algeria. Abstract, International Symposium on Crop Protection, Gent, Belgium, May 1998, p. 96.

Kheyr-Pour A, Bendahmane M, Matzeit V, Accotto GP, Crespi S, Gronenborn B, 1991. Tomato yellow leaf curl virus from Sardinia is a whitefly-transmitted monopartite geminivirus. Nucleic Acids Research, 19(24):6763-6769

Kim SueHoon, Oh Sung, Oh TaeKyun, Park JaeSung, Kim SeiChang, Kim SeongHwan, Kim YoungShik, Hong JeumKyu, Sim SangYun, Park KwonSeo, Lee HwanGu, Kim KyungJae, Choi ChangWon, 2011. Genetic diversity of tomato-infecting Tomato yellow leaf curl virus (TYLCV) isolates in Korea. Virus Genes, 42(1):117-127. http://springerlink.metapress.com/link.asp?id=103010

Konate G, Barro N, Fargette D, Swanson MM, Harrison BD, 1995. Occurrence of whitefly-transmitted geminiviruses in crops in Burkina Faso, and their serological detection and differentiation. Annals of Applied Biology, 126(1):121-129

Kunik T, Salomon R, Zamir D, Navot N, Zeidan M, Michelson I, Gafni Y, Czosnek H, 1994. Transgenic tomato plants expressing the tomato yellow leaf curl virus capsid protein are resistant to the virus. Bio/Technology, 12(5):500-504

Lapidot M, Friedmann M, Lachman O, Yehezkel A, Nahon S, Cohen S, Pilowsky M, 1997. Comparison of resistance level to tomato yellow leaf curl virus among commercial cultivars and breeding lines. Plant Disease, 81(12):1425-1428; 13 ref.

Laufs J, Traut W, Heyraud F, Matzeit V, Rogers SG, Schell J, Gronenborn B, 1995. In vitro cleavage and joining at the viral origin of replication by the replication initiator protein of tomato yellow leaf curl virus. Proceedings of the National Academy of Sciences of the United States of America, 92(9):3879-3883

Lee H, Song W, Kwak HR, Kim JD, Park J, Auh CK, Kim DH, Lee KY, Lee S, Choi HS, 2010. Phylogenetic analysis and inflow route of Tomato yellow leaf curl virus (TYLCV) and Bemisia tabaci in Korea. Molecules and Cells, 30:467-476.

Lefeuvre P, Martin DP, Harkins G, Lemey P, Gray AJA, Meredith S, Lakay F, Monjane A, Lett JM, Varsani A, Heydarnejad J, 2010. The spread of Tomato yellow leaf curl virus from the Middle East to the world. PLoS Pathogens, No.October:e1001164. http://www.plospathogens.org/article/info%3Adoi%2F10.1371%2Fjournal.ppat.1001164

Lepoivre P, 2001. Editorial: Les systemes de production agricole et la protection des cultures a la croisTe des chemins. Biotechnologie, Agronomie, SociTtT et Environnement, 5:195-199.

Lett JM, Péréfarres F, Hoareau M, Lefeuvre P, Bruyn Ade, Dottin M, Prior P, Wicker E, Umaharan P, 2011. Tomatoes showing yellow leaf curl symptoms in the island of Grenada exhibit an infection with Tomato yellow leaf curl virus either alone or in combination with Potato yellow mosaic virus. New Disease Reports, 24:Article 19. http://www.ndrs.org.uk/article.php?id=024019

Lobin K, Druffel KL, Pappu HR, Benimadhu SP, 2010. First report of Tomato yellow leaf curl virus in tomato in Mauritius. Plant Disease, 94(10):1261. http://apsjournals.apsnet.org/loi/pdis

Lomonossoff GP, 1995. Pathogen-derived resistance to plant viruses. Annual Review of Phytopathology, 33:323-343.

Louro D, Noris E, Veratti F, Accotto GP, 1996. First report of tomato yellow leaf curl virus in Portugal. Plant Disease, 80(9):1079; 1 ref.

MacIntosh S, Robinson DJ, Harrison BD, 1992. Detection of three whitefly-transmitted geminiviruses occurring in Europe by tests with heterologous monoclonal antibodies. Annals of Applied Biology, 121(2):297-303

Makkouk KM, 1978. A study on tomato viruses in the Jordan Valley with special emphasis on tomato yellow leaf curl. Plant Disease Reporter, 62(3):259-262

Makkouk KM, Laterrot H, 1983. Epidemiology and control of tomato yellow leaf curl virus. In: Plumb RT, Thresh JM, ed. Plant virus epidemiology. The spread and control of insect-borne viruses. Oxford, United Kingdom: Blackwell Scientific Publications, 315-321.

Makkouk KM, Shehab S, Majdalani SE, 1979. Tomato yellow leaf curl: incidence, yield and losses and transmission in Lebanon. Phytopathologische Zeitschrift, 96(3):263-267

Mansour A, Al-Musa A, 1992. Tomato yellow leaf curl virus: host range and virus-vector relationships. Plant Pathology, 41(2):122-125

Matsuura S, Hoshino S, 2008. Comparative spatial dispersal of Tomato yellow leaf curl virus vectored by B and Q biotypes of Bemisia tabaci in tomato glasshouses. Phytoparasitica, 36(1):42-51. http://www.phytoparasitica.org

Mazyad HM, Nakhla MK, El-Amrety AA, Dos SA, 1986. Further studies on the epidemiology of tomato yellow leaf curl virus in Egypt. Egypt Acta Horticulturae, 190:121-130.

Mazyad HM, Omar F, Al-Taher K, Salha M, 1979. Observations on the epidemiology of tomato yellow leaf curl disease on tomato plants. Plant Disease Reporter, 63(8):695-698

McGlashan D, Polston JE, Bois D, 1994. Tomato yellow leaf curl geminivirus in Jamaica. Plant Disease, 78(12):1219

McGrath PF, Harrison BD, 1995. Transmission of tomato leaf curl geminiviruses by Bemisia tabaci: effects of virus isolate and vector biotype. Annals of Applied Biology, 126(2):307-316

Mehta P, Wyman JA, Nakhla MK, Maxwell DP, 1994. Transmission of tomato yellow leaf curl geminivirus by Bemisia tabaci (Homoptera: Aleyrodidae). Journal of Economic Entomology, 87(5):1291-1297

Melzer MJ, Ogata DY, Fukuda SK, Shimabuku R, Borth WB, Sether DM, Hu JS, 2010. First report of Tomato yellow leaf curl virus in Hawaii. Plant Disease, 94(5):641. http://apsjournals.apsnet.org/loi/pdis

Michelson I, Zamir D, Czosnek H, 1994. Accumulation and translocation of tomato yellow leaf curl virus (TYLCV) in a Lycopersicon esculentum breeding line containing the L. chilense TYLCV tolerance gene Ty-1. Phytopathology, 84(9):928-933

Milne RG, Luisoni E, 1977. Rapid immune electron microscopy of virus preparation. Methods in Virology, 6:265-281.

Mnari-Hattab M, Zammouri S, Hajlaoui MR, 2014. First report of hard watermelon syndrome in Tunisia associated with Tomato yellow leaf curl virus infection. New Disease Reports, 30:7. http://www.ndrs.org.uk/article.php?id=030007

Momol MT, Simone GW, Dankers W, Sprenkel RK, Olson SM, Momol EA, Polston JE, Hiebert E, 1999. First report of tomato yellow leaf curl virus in tomato in south Georgia. Plant Disease, 83(5):487; 2 ref.

Monci F, Navas-Castillo J, Cenis JL, Lacasa A, Benazoun A, Moriones E, 2000. Spread of tomato yellow leaf curl virus Sar from the Mediterranean basin: presence in the Canary Islands and Morocco. Plant Disease, 84(4):490; 3 ref.

Monci F, Navas-Castillo J, Moriones E, 2001. Evidence of a naturally occurring recombinant between tomato yellow leaf curl virus and tomato yellow leaf curl Sardinia virus in Spain. Plant Disease, 85(12):1289; 2 ref.

Monci F, Sánchez-Campos S, Navas-Castillo J, Moriones E, 2002. A natural recombinant between the geminiviruses Tomato yellow leaf curl Sardinia virus and Tomato yellow leaf curl virus exhibits a novel pathogenic phenotype and is becoming prevalent in Spanish populations. Virology, 303(2):317-326.

Montasser MS, Al-Sharidah A, Ali NY, Nakhla MK, Farag BL, Maxwell DP, 1999. A single DNA of tomato yellow leaf curl geminivirus causing epidemics in the State of Kuwait. Kuwait Journal of Science & Engineering, 26(1):127-141; 27 ref.

Morilla G, Antúnez C, Bejarano ER, Janssen D, Cuadrado IM, 2003. A new Tomato yellow leaf curl virus strain in Southern Spain. Plant Disease, 87(8):1004.

Morilla G, Krenz B, Jeske H, Bejarano ER, Wege C, 2004. Tête à Tête of Tomato yellow leaf curl virus and Tomato yellow leaf curl Sardinia virus in single nuclei. Journal of Virology, 78(19):10715-10723. http://jvi.asm.org/cgi/content/abstract/78/19/10715

Morin S, Ghanim M, Zeidan M, Czosnek H, Verbeek M, Heuvel JFJMvan den, 1999. A GroEL homologue from endosymbiotic bacteria of the whitefly Bemisia tabaci is implicated in the circulative transmission of tomato yellow leaf curl virus. Virology (New York), 256(1):75-84.

Moriones E, Arno J, Accotto GP, Noris E, Cavallarin L, 1993. First report of tomato yellow leaf curl virus in Spain. Plant Disease, 77(9):953.

Moriones E, García-Andrés S, 2008. Diagnosis of begomoviruses. In: Techniques in diagnosis of plant viruses [ed. by Rao, G. P.\Valverde, R. A.\Dovas, C. I.]. Houston, USA: Studium Press LLC, 165-187.

Moriones E, Navas-Castillo J, 2000. Tomato yellow leaf curl virus, an emerging virus complex causing epidemics worldwide. Virus Research [Special Issue: Plant Virus Epidemiology: challenges for the twenty-first century, Almeria, Spain, 11-16 April 1999.], 71(1/2):123-134.

Morris J, 1997. A Multiplex PCR method for the simultaneous detection of Tomato yellow leaf curl and Tomato mottle geminiviruses. British Society for Plant Pathology Presidential Meeting. Plant Pathology - Global Perspectives of an Applied Science. Offered Posters.

Murad Ghanim, Shai Morin, Czosnek H, 2001. Rate of Tomato yellow leaf curl virus translocation in the circulative transmission pathway of its vector, the whitefly Bemisia tabaci. Phytopathology, 91(2):188-196; 36 ref.

Nakhla MK, Maxwell DP, 1998. Epidemiology and management of tomato yellow leaf curl disease. In: Hadidi A, Khetarpal RK, Koganezawa H, eds. Plant Virus Disease Control. St Paul, USA: APS Press, 565-583.

Nakhla MK, Maxwell DP, Martinez RT, Carvalho MG, Gilbertson RL, 1994. Widespread occurrence of the eastern Mediterranean strain of tomato yellow leaf curl geminivirus in tomatoes in the Dominican Republic. Plant Disease, 78(9):926

Nakhla MK, Mazyad HM, Maxwell DP, 1993. Molecular characterization of four tomato yellow leaf curl virus isolates from Egypt and development of diagnostic methods. Phytopathologia Mediterranea, 32(3):163-173

Navas-Castillo J, Dfaz JA, Sßnchez-Campos S, Moriones E, 1998. Short communication. Improvement of the print-capture polymerase chain reaction procedure for efficient amplification of DNA virus genomes from plants and insect vectors. Journal of Virological Methods, 75(2):195-198; 9 ref.

Navas-Castillo J, Sanchez-Campos S, Diaz JA, 1999. Tomato yellow leaf curl virus causes a novel disease of common bean and severe epidemics in tomato in Spain. Plant Disease, 83:29-32.

Navas-Castillo J, Sßnchez-Campos S, Noris E, Louro D, Accotto GP, Moriones E, 2000. Natural recombination between Tomato yellow leaf curl virus-Is and Tomato leaf curl virus. Journal of General Virology, 81(11):2797-2801; 28 ref.

Navot N, Ber R, Czosnek H, 1989. Rapid detection of tomato yellow leaf curl virus in squashes of plants and insect vectors. Phytopathology, 79(5):562-568

Navot N, Pichersky E, Zeiden M, Zamir D, Czosnek H, 1991. Tomato yellow leaf curl virus: A whitefly-transmitted geminivirus with a single genomic component. Virology, 185:151-161.

Navot N, Zeidan M, Pichersky E, Zamir D, Czosnek H, 1992. Use of the polymerase chain reaction to amplify tomato yellow leaf curl virus DNA from infected plants and viruliferous whiteflies. Phytopathology, 82(10):1199-1202

Noris E, Accotto GP, Tavazza R, Brunetti A, Crespi S, Tavazza M, 1996. Resistance to tomato yellow leaf curl geminivirus in Nicotiana benthamiana plants transformed with a truncated viral C1 gene. Virology (New York), 224(1):130-138.

Noris E, Lucioli A, Tavazza R, Caciagli P, Accotto GP, Tavazza M, 2004. Tomato yellow leaf curl Sardinia virus can overcome transgene-mediated RNA silencing of two essential viral genes. Journal of General Virology, 85(6):1745-1749.

Noueiry AO, Lucas WJ, Gilbertson RL, 1994. Two proteins of a plant DNA virus coordinate nuclear and plasmodesmal transport. Cell (Cambridge), 76(5):925-932

Oliveira MRV, Queiroz PR, Vilarinho KR, Lima LHC, 2005. Current status of the whitefly Bemisia tabaci as an introduced pest in Brazil. In: Plant protection and plant health in Europe: introduction and spread of invasive species, held at Humboldt University, Berlin, Germany, 9-11 June 2005 [ed. by Alford, D. V.\Backhaus, G. F.]. Alton, UK: British Crop Protection Council, 269-270.

Osaki H, Nomiyama K, Ishikawa K, 2011. Application of serological techniques for the diagnosis of tomato yellow leaf curl disease. Bulletin of the National Agricultural Research Center for Western Region, No.10:13-27.

Padidam M, Beachy RN, Fauquet CM, 1995. Classification and identification of geminiviruses using sequence comparisons. Journal of General Virology, 76:249-263.

Padidam M, Beachy RN, Fauquet CM, 1996. The role of AV2 ("precoat") and coat protein in viral replication and movement in tomato leaf curl geminivirus. Virology (New York), 224(2):390-404; 50 ref.

Padidam M, Sawyer S, Fauquet CM, 1999. Possible emergence of new geminiviruses by frequent recombination. Virology (New York), 265(2):218-225; 55 ref.

Papayiannis LC, Katis NI, Idris AM, Brown JK, 2011. Identification of weed hosts of Tomato yellow leaf curl virus in Cyprus. Plant Disease, 95(2):120-125. http://apsjournals.apsnet.org/loi/pdis

Pappu SS, Pappu HR, Langston DBJr, Flanders JT, Riley DG, Diaz-Perez JC, 2000. Outbreak of tomato yellow leaf curl virus (family Geminiviridae) in Georgia. Plant Disease, 84(3):370-370; 4 ref.

Parrella G, Nappo AG, Giorgini M, Stinca A, 2016. Urtica membranacea: a new host for Tomato yellow leaf curl virus and Tomato yellow leaf curl Sardinia virus in Italy. Plant Disease, 100(2):539-540. http://apsjournals.apsnet.org/loi/pdis

Pelet F, 1992. Virus and virus-like diseases of tomato. Revue Suisse de Viticulture, d'Arboriculture et d'Horticulture, 24(1):41-44

Péréfarres F, Bruyn Ade, Kraberger S, Hoareau M, Barjon F, Lefeuvre P, Pellegrin F, Caplong P, Varsani A, Lett JM, 2012. Occurrence of the Israel strain of Tomato yellow leaf curl virus in New Caledonia and Loyalty Islands. New Disease Reports, 25:6. http://www.ndrs.org.uk/article.php?id=025006

Peterschmitt M, Granier M, Mekdoud R, Dalmon A, Gambin O, Vayssieres JF, Reynaud B, 1999. First report of tomato yellow leaf curl virus in RTunion Island. Plant Disease, 83(3):303; 2 ref.

Pico B, Dfez MJ, Nuez F, 1996. Viral diseases causing the greatest economic losses to the tomato crop. II. The tomato yellow leaf curl virus - a review. Scientia Horticulturae, 67(3/4):151-196; 9 pp. of ref.

Pilowski M, Cohen S, 1990. Tolerance to tomato yellow leaf curl virus derived from Lycopersicon esculentum. Plant Disease, 74:248-250.

Pilowsky M, Cohen S, Ben-Joseph R, Nahon S, 1993. Effect of tomato yellow leaf curl virus on tolerant and susceptible cultivars. Proceedings of the XIIth Eucarpia meeting on tomato genetics and breeding, Plovdiv, Bulgaria, 27-31 July 1993., 31-32.

Polizzi G, Areddia R, 1992. Tomato yellow leaf curl in Calabria. Informatore Fitopatologico, 42(10):47-49

Polston JE, 1998. Tomato yellow leaf curl virus-USA (Florida). World Wide Web Page at http://www.agnic.org/pmp/1998/tyl0515.html.

Polston JE, Anderson PK, 1997. The emergence of whitefly-transmitted geminiviruses in tomato in the western hemisphere. Plant Disease, 81(12):1358-1369; 103 ref.

Polston JE, Bois D, Serra CA, Concepcion S, 1994. First report of a tomato yellow leaf curl-like geminivirus in the Western Hemisphere. Plant Disease, 78(8):831

Polston JE, Hiebert E, 2007. Transgenic approaches for the control of Tomato yellow leaf curl virus. In: The Tomato Yellow Leaf Curl Virus Disease: Management, Molecular Biology, Breeding for Resistance [ed. by Czosnek, H.]. Dordrecht, The Netherlands: Springer, 373-390.

Polston JE, Lapidot M, 2008. Tomato yellow leaf curl virus. In: Characterization, diagnosis & management of plant viruses. Volume 3: vegetable and pulse crops [ed. by Rao, G. P.\Kumar, P. L.\Holguin-Peña, R. J.]. Houston, USA: Studium Press LLC, 141-161.

Polston JE, McGovern RJ, Brown LG, 1999. Introduction of tomato yellow leaf curl virus in Florida and implications for the spread of this and other geminiviruses of tomato. Plant Disease, 83(11):984-988; 22 ref.

Polston JE, McGovern RJ, Sherwood T, Kelly R, 1999. New developments in tomato yellow leaf curl virus in Florida. In: 1999 Proceedings of the Florida Tomato Institute, Naples, FL, USA, PRO-516. Gainesville, FL, USA: University of Florida, IFAS, 2-5.

Polston JE, Rosebrock TR, Sherwood T, Creswell T, Shoemaker PJ, 2002. Appearance of Tomato yellow leaf curl virus in North Carolina. Plant Disease, 86(1):73; 4 ref.

Polston JE, Sherwood T, Rosell R, Nava A, 2001. Detection of tomato yellow leaf curl and tomato mottle virus in developmental stages of the whitefly vector, Bemisia tabaci. Third International Geminivirus Symposium, John Innes Centre, Abtract 81.

Polston JE, Yang Y, Sherwood T, Bucher C, Freitas-Astua, Hiebert E, 2001. Effective resistance to tomato yellow leaf curl virus (TYLCV) in tomato and tobacco mediated by a truncated TYLCV Rep gene. Third International Geminivirus Symposium, John Innes Centre, Abstract 82.

Poolpol P, 1986. Dot immunobinding assay for tropical plant viruses. In: Kustak E, ed. Proceeding of the First International Conference on the Impact of Viral diseases on the Development of Asian Countries, December 7-13, 1986. Bangkok, Thailand, 214.

Qui±ones M, Fonseca D, Martinez Y, Accotto G-P, 2002. First Report of Tomato yellow leaf curl virus infecting pepper plants in Cuba. Plant Disease, 86:73.

Quiñónez M, Fonseca D, Gómez O, Miranda I, Piñón M, Martínez Y, 2003. Optimization and application of the non-radioactive nucleic acid hybridization for the diagnostic of tomato yellow leaf curl virus (TYLCV) in the breeding program. (Optimización y aplicación de la hibridación de ácidos nucleicos no radioactiva para el diagnóstico del virus del encrespamiento amarillo de la hoja del tomate (TYLCV) en el programa de mejoramiento genético.) Revista de Protección Vegetal, 18(3):176-182.

Ramos PL, Guerra O, Dorestes V, Ramirez N, Rivera-Bustamante R, Oramas P, 1996. Detection of TYLCV in Cuba. Plant Disease, 80(10):1208; 2 ref.

Rapisarda C, 1990. Bemisia tabaci vector of TYLCV in Sicily. Informatore Fitopatologico, 40(6):27-31

Rashid MH, Hossain I, Hannan A, Uddin SA, Hossain MA, 2008. Effect of different dates of planting time on prevalence of Tomato Yellow Leaf Curl Virus and whitefly of tomato. Journal of Soil and Nature, 2(1):1-6. http://www.gwf.org.bd/JSN(Calander).htm

Regenmortel MHVvan, Fauquet CM, Bishop DHL, Carstens EB, Estes MK, Lemon SM, Maniloff J, Mayo MA, McGeoch DJ, Pringle CR, Wickner RB, 2000. Virus taxonomy: classification and nomenclature of viruses. Seventh report of the International Committee on Taxonomy of Viruses. xii + 1162 pp.; many ref.

Rochester DE, DePaulo JJ, Fauquet CM, Beachy RN, 1994. Complete nucleotide sequence of the geminivirus tomato yellow leaf curl virus, Thailand isolate. Journal of General Virology, 75(3):477-485

Rom M, Antignus Y, Gidoni D, Pilowsky M, Cohen S, 1993. Accumulation of tomato yellow leaf curl virus DNA in tolerant and susceptible tomato lines. Plant Disease, 77(3):253-257

Roth BM, Pruss GJ, Vance VB, 2004. Plant viral suppressors of RNA silencing. Virus Research, 102(1):97-108.

Rubinstein G, Czosnek H, 1997. Long-term association of tomato yellow leaf curl virus with its whitefly vector Bemisia tabaci: effect on the insect transmission capacity, longevity and fecundity. Journal of General Virology, 78(10):2683-2689; 26 ref.

Rubinstein G, Morin S, Czosnek H, 1999. Long-term effect of imidacloprid on mortality of the whitefly Bemisia tabaci caged with treated eggplant and tomato, and on transmission of tomato yellow leaf curl geminivirus (TYLCV) to tomato. Journal of Economical Entomology, 92:658-662.

Rybicki EP, 1994. A phylogenetic and evolutionary justification for three genera of Geminiviridae. Archives of Virology, 139(1-2):49-77

Salati R, Shorey M, Briggs A, Calderon J, Rojas MR, Chen LF, Gilbertson RL, Palmieri M, 2010. First report of Tomato yellow leaf curl virus infecting tomato, tomatillo, and peppers in Guatemala. Plant Disease, 94(4):482-483. http://apsjournals.apsnet.org/loi/pdis

Sánchez-Campos S, Díaz JA, Monci F, Bejarano ER, Reina J, Navas-Castillo J, Aranda MA, Moriones E, 2002. High genetic stability of the begomovirus Tomato yellow leaf curl Sardinia virus in southern Spain over an 8-year period. Phytopathology, 92(8):842-849.

Sanderfoot AA, Lazarowitz SG, 1995. Cooperation in vital movement: the geminivirus BL1 movement protein interacts with BR1 and redirects it from the nucleus to the cell periphery. Plant Cell, 7(8):1185-1194; 36 ref.

Scholthof KBG, Adkins S, Czosnek H, Palukaitis P, Jacquot E, Hohn T, Hohn B, Saunders K, Candresse T, Ahlquist P, Hemenway C, Foster GD, 2011. Top 10 plant viruses in molecular plant pathology. Molecular Plant Pathology, 12(9):938-954. http://onlinelibrary.wiley.com/journal/10.1111/(ISSN)1364-3703

Schuster DJ, Stansly PA, Polston JE, Gilreath PR, McAvoy E, 2007. Management of whiteflies, whitefly-vectored plant virus, and insecticide resistance for vegetable production in Southern Florida. ENY-735 (IN695), a publication of the Entomology and Nematology Department, Florida Cooperative Extension Service, Institute of Food and Agricultural Sciences, University of Florida. Florida, USA: University of Florida.

Shahid MS, Natsuaki KT, 2014. Identification of Tomato yellow leaf curl virus naturally infecting common bean in Japan. Plant Disease, 98(10):1447. http://apsjournals.apsnet.org/loi/pdis

Sinisterra X, Patte CP, Siewnath S, Polston JE, 2000. Identification of tomato yellow leaf curl virus-Is in the Bahamas. Plant Disease, 84(5):592; 2 refs.

Sinisterra XH, Polston JE, Abouzid AM, Hiebert E, 1999. Tobacco plants transformed with a modified coat protein of tomato mottle begomovirus show resistance to virus infection. Phytopathology, 89(8):701-706; 35 ref.

Smith NA, Singh SP, Wang MingBo, Stoutjesdijk PA, Green AG, Waterhouse PM, 2000. Total silencing by intron-spliced hairpin RNAs. Nature (London), 407(6802):319-320.

Sßnchez-Campos S, Navas-Castillo J, Camero R, Soria C, Dfaz JA, Moriones E, 1999. Displacement of tomato yellow leaf curl virus (TYLCV)-Sr by TYLCV-Is in tomato epidemics in Spain. Phytopathology, 89(11):1038-1043; 30 ref.

Stansly PA, Naranjo SE, 2010. Bemisia, Bionomics and Management of a Global Pest. Dordrecht, Heidelberg, London, New York, The Netherlands, Germany, UK, USA: Springer.

Taylor B, Powell A, 1982. Isolation of plant RNA and DNA. Bethesda Research Laboratories (BRL) Focus, 4:4-6.

Tesoriero L, Azzopardi S, 2006. Tomato yellow leaf curl virus in Australia. Primefact, 220:1-2.

Thanapase V, Poolpol P, Sutabutra T, Attathom S, 1983. Causal agent and some important characteristics of tomato yellow leaf curl disease. Kasetsart Journal, 17:65-73.

Thomas JE, Massalski PR, Harrison BD, 1986. Production of monoclonal antibodies to African cassava mosaic virus and differences in their reactivities with other whitefly-transmitted geminiviruses. Journal of General Virology, 67:2739-2748.

Thongrit D, Attathom S, Sutabutra T, 1986. Tomato yellow leaf curl virus in Thailand. In: Plant Virus Diseases of Horticultural Crops in the Tropics and Subtropics. FFTC Book Series No.33. Taipei, Taiwan, 60-63.

Tiberini A, Tomassoli L, Barba M, Hadidi A, 2010. Oligonucleotide microarray-based detection and identification of 10 major tomato viruses. Journal of Virological Methods, 168(1/2):133-140. http://www.sciencedirect.com/science/journal/01660934

Traboulsi R, 1994. Bemisia tabaci: a report on its pest status with particular reference to the Near East. FAO Plant Protection Bulletin, 42(1/2):33-58

Ueda S, Takeuchi S, Okabayashi M, Hanada K, Tomimura K, Iwanami T, 2005. Evidence of a new Tomato yellow leaf curl virus in Japan and its detection using PCR. Journal of General Plant Pathology, 71(4):319-325.

Umaharan P, Padidam M, Phelps RH, Beachy RN, Fauquet CM, 1998. Distribution and diversity of geminiviruses in Trinidad and Tobago. Phytopathology, 88(12):1262-1268; 32 ref.

Valverde RA, Lotrakul P, Landry AD, Boudreaux JE, 2001. First report of tomato yellow leaf curl virus in Louisiana. Plant Disease, 85(2):230; 2 ref.

Vidavski F, Czosnek H, Gazit S, Levy D, Lapidot M, 2008. Pyramiding of genes conferring resistance to Tomato yellow leaf curl virus from different wild tomato species. Plant Breeding, 127(6):625-631. http://www.blackwell-synergy.com/loi/pbr

Vidavsky F, Czosnek H, 1998. Tomato breeding lines resistant and tolerant to tomato yellow leaf curl virus issued from Lycopersicon hirsutum. Phytopathology, 88(9):910-914; 22 ref.

Vidavsky F, Leviatov S, Milo J, Rabinowitch HD, Kedar N, Czosnek H, 1998. Response of tolerant breeding lines of tomato, Lycopersicon esculentum, originating from three different sources (L. peruvianum, L. pimpinellifolium and L. chilense) to early controlled inoculation by tomato yellow leaf curl virus (TYLCV). Plant Breeding, 117(2):165-169; 17 ref.

Voinnet O, Pinto YM, Baulcombe DC, 1999. Suppression of gene silencing: a general strategy used by diverse DNA and RNA viruses of plants. Proceedings of the National Academy of Sciences of the United States of America, 96(24):14147-14152.

Wartig L, Kheyr-Pour A, Noris E, Kouchkovsky Fde, Jouanneau F, Gronenborn B, Jupin I, 1997. Genetic analysis of the monopartite tomato yellow leaf curl geminivirus: roles of V1, V2, and C2 ORFs in viral pathogenesis. Virology (New York), 228(2):132-140; 51 ref.

Wernecke MA, Roye ME, McLaughlin WA, Nakhla MK, Maxwell DP, 1997. Identification of tomato yellow leaf curl geminivirus (TYLCV-Is) in tomatoes and peppers in Jamaica. GenBank accessions U84146, U84147, U84397, U85782.xxx.

Williams LIII, Dennehy TJ, Palumbo JC, 1997. Defining the risk of resistance to imidacloprid in Arizona populations of whitefly. 1997 Proceedings Beltwide Cotton Conferences, New Orleans, LA, USA, January 6-10, 1997: Volume 2., 1242-1246; 12 ref.

Wilson KI, Al-Beldawi AS, Amin M, Nema HA, 1981. Solanum nigrum, a new host of tomato yellow leaf curl virus. Plant Disease, 65(12):979

Wu JB, Dai FM, Zhou XP, 2006. First report of Tomato yellow leaf curl virus in China. Plant Disease, 90(10):1359. HTTP://www.apsnet.org

Xu Y, Cai X, Zhou X, 2007. Tomato leaf curl Guangxi virus is a distinct monopartite begomovirus species. European Journal of Plant Pathology, 118:287-294.

Yang Y, Sherwood TA, Patte CP, Hiebert E, Polston JE, 2004. Use of Tomato yellow leaf curl virus (TYLCV) Rep gene sequences to engineer TYLCV resistance in tomato. Phytopathology, 94(5):490-496.

Yassin AM, 1989. Major disease problems of tomato production and their control in the Sudan. Tomato and pepper production in the tropics. Proceedings of the international symposium on integrated management practices, Tainan, Taiwan, 21-26 March 1988., 561-565; 26 ref.

Yassin AM, Nour MA, 1965. Tomato leaf curl diseases in the Sudan and their relation to tobacco leaf curl. Annals of Applied Biology, 56:207-217.

Yilmaz MA, Kaska N, Cinar A, Gezerel O, 1980. Reduction of virus disease effects on tomato by barriers in Cukurova Region. Journal of Turkish Phytopathology, 9(2-3):67-75

Yin QY, Yang HY, Gong QH, Wang HY, Liu YL, Hong YG, Tien P, 2001. Tomato yellow leaf curl China virus: monopartite genome organization and agroinfection of plants. Virus Research, 81:69-76.

Yongping Z, Weimin Z, Huimei C, Yang Q, Kun S, Yanhui W, Longying Z, Zhang YL, 2008. Molecular identification and the complete nucleotide sequence of TYLCV isolate from Shanghai of China. Virus Genes, 36:547-551.

Yu WenGui, Zhao TongMin, Yang MaLi, Zhao LiPing, Ji YingHua, Zhou YiJun, 2009. PCR detection and sequence analysis of whitefly-transmitted geminivirus in tomato from Anhui and Shandong provinces. Jiangsu Journal of Agricultural Sciences, 25(4):747-751. http://www.jaas.ac.cn

Zakay Y, Navot N, Zeidan M, Kedar N, Rabinowitch H, Czosnek H, Zamir D, 1991. Screening Lycopersicon accessions for resistance to tomato yellow leaf curl virus: presence of viral DNA and symptom development. Plant Disease, 75(3):279-281

Zambrano K, Carballo O, Geraud F, Chirinos D, Fernández C, Marys E, 2007. First report of Tomato yellow leaf curl virus in Venezuela. Plant Disease, 91(6):768. HTTP://www.apsnet.org

Zamir D, Ekstein-Michelson I, Zakay Y, Navot N, Zeidan M, Sarfatti M, Eshed Y, Harel E, Pleban T, Oss H van, Kedar N, Rabinowitch HD, Czosnek H, 1994. Mapping and introgression of a tomato yellow leaf curl virus tolerance gene, TY-1. Theoretical and Applied Genetics, 88(2):141-146

Zammouri S, Mnari-Hattab M, 2014. First report of Solanum elaeagnifolium as natural host of Tomato yellow leaf curl virus species (TYLCV and TYLCSV) in Tunisia. Journal of Plant Pathology, 96(2):434. http://www.sipav.org/main/jpp/

Zeidan M, Czosnek H, 1991. Acquisition of yellow leaf curl virus by the whitefly Bemisia tabaci. Journal of General Virology, 72(11):2607-2614

Zhang Hui, Gong HuanRan, Zhou XuePing, 2009. Molecular characterization and pathogenicity of tomato yellow leaf curl virus in China. Virus Genes, 39(2):249-255. http://springerlink.metapress.com/link.asp?id=103010

Zhang Wei, Olson NH, Baker TS, Faulkner L, Agbandje-McKenna M, Boulton MI, Davies JW, McKenna R, 2001. Structure of the maize streak virus geminate particle. Virology (New York), 279(2):471-477; 37 ref.

Zhao TongMin, Yu WenGui, Zhou YiJun, Ji YingHua, 2007. The occurrence and diagnosis of Tomato yellow leaf curl disease (TYLCD) in Jiangsu Province, China. Jiangsu Journal of Agricultural Sciences, 23(6):654-655. http://www.jaas.ac.cn

Zhou Y, Luo C, Zhao J, Wei SJ, Chen Z, Yan JY, Li XH, 2016. First report of Tomato yellow leaf curl virus in Viola prionantha in China. Plant Disease, 100(1):231. http://apsjournals.apsnet.org/loi/pdis

Zhou YC, Noussourou M, Kon T, Rojas MR, Jiang H, Chen LF, Gamby K, Foster R, Gilbertson RL, 2008. Evidence of local evolution of tomato-infecting begomovirus species in West Africa: characterization of tomato leaf curl Mali virus and tomato yellow leaf crumple virus from Mali. Archives of Virology, 153(4):693-706. http://springerlink.metapress.com/content/95264n71216ut7x1/?p=946bf8e65c9a4164a597ff8e969099eb&pi=9

Zilberstein A, Navot N, Ovadia S, Reinhartz A, Herzberg M, Czosnek H, 1989. Field-usable assay for diagnosis of the tomato yellow leaf curl virus in squashes of plants and insects by hybridization with a chromogenic DNA probe. Technique, a Journal of Methods in Cell and Molecular Biology, 1(2):118-124

Zouba A, Azam KM, Razvi SA, Ai-Wahaibi AK, 1993. Temporal increase of tomato leaf curl virus on staggered plantings of tomato in the Sultanate of Oman. South Indian Horticulture, 41(1):28-32

Zrachya A, Kumar PP, Usha Ramakrishnan, Levy Y, Loyter A, Arazi T, Lapidot M, Gafni Y, 2007. Production of siRNA targeted against TYLCV coat protein transcripts leads to silencing of its expression and resistance to the virus. Transgenic Research, 16(3):385-398. http://springerlink.metapress.com/link.asp?id=100225

Zubiaur YM, Zabalgogeazcoa I, Blas Cde, Sßnchez F, Peralta EL, Romero J, Ponz F, 1996. Geminiviruses associated with diseased tomatoes in Cuba. Journal of Phytopathology, 144(5):277-279; 10 ref.

Links to Websites

Organizations

Israel: Agricultural Research Organization, Bet Dagen, www.volcani.gov.il

Israel: The Hebrew University of Jerusalem, Faculty of Agriculture, Rehovot, www.agri.huji.ac.il

Taiwan: Asian Vegetable Research and Development Center, Tainan, www.avrdc.org

Spain: Instituto de Hortofruticultura Subtropical y Meditarránea, Malaga, www.eelm.csic.es

USA: University of Arizona, Tucson, Arizona, www.arizona.edu

USA: University of California at Davis, Davis, California, www.ucdavis.edu

USA: University of Florida - Gainesville, Gainesville, Florida, www.ufl.edu

Contributors

01/01/12 Review by:

Henryk Czosnek, The Haim Gvati Professor of Agriculture, Institute of Plant Sciences and Genetics in Agriculture, Faculty of Agriculture, Food and Environment, The Hebrew University of Jerusalem, Rehovot 76100, Israel.

Distribution Maps