Invasive Species Compendium

Detailed coverage of invasive species threatening livelihoods and the environment worldwide

Datasheet

Ralstonia solanacearum
(bacterial wilt of potato)

Osdaghi E, 2020. Ralstonia solanacearum (bacterial wilt of potato). Invasive Species Compendium. Wallingford, UK: CABI. DOI:10.1079/ISC.45009.20210200782

Toolbox

Datasheet

Ralstonia solanacearum (bacterial wilt of potato)

Summary

  • Last modified
  • 10 July 2020
  • Datasheet Type(s)
  • Invasive Species
  • Pest
  • Natural Enemy
  • Preferred Scientific Name
  • Ralstonia solanacearum
  • Preferred Common Name
  • bacterial wilt of potato
  • Taxonomic Tree
  • Domain: Bacteria
  •   Phylum: Proteobacteria
  •     Class: Betaproteobacteria
  •       Order: Burkholderiales
  •         Family: Ralstoniaceae
  • Summary of Invasiveness
  • Ralstonia solanacearum is included in the A2 (high risk) list of quarantine organisms by the European and Mediterranean Plant Protection Organization (EPPO). EPPO Code for R. solanacearum is RALSSO, while the phytosanitary catego...

Don't need the entire report?

Generate a print friendly version containing only the sections you need.

Generate report

Pictures

Top of page
PictureTitleCaptionCopyright
Left: early wilting symptoms in a potato plant (natural infection).
Right: severe wilting symptoms in potato, caused by R. solanacearum (natural infection).
TitleDamage symptoms
CaptionLeft: early wilting symptoms in a potato plant (natural infection). Right: severe wilting symptoms in potato, caused by R. solanacearum (natural infection).
Copyright©J.D. Janse
Left: early wilting symptoms in a potato plant (natural infection).
Right: severe wilting symptoms in potato, caused by R. solanacearum (natural infection).
Damage symptomsLeft: early wilting symptoms in a potato plant (natural infection). Right: severe wilting symptoms in potato, caused by R. solanacearum (natural infection).©J.D. Janse
Potato plants have wilted and leaves have become brown due to R. solanacearum.
TitleDamage symptoms
CaptionPotato plants have wilted and leaves have become brown due to R. solanacearum.
Copyright©Mauritius Sugar Industry Research Institute
Potato plants have wilted and leaves have become brown due to R. solanacearum.
Damage symptomsPotato plants have wilted and leaves have become brown due to R. solanacearum.©Mauritius Sugar Industry Research Institute
Pepper plants show wilting due to bacterial infection.
TitleDamage symptoms
CaptionPepper plants show wilting due to bacterial infection.
Copyright©CABI BioScience
Pepper plants show wilting due to bacterial infection.
Damage symptomsPepper plants show wilting due to bacterial infection.©CABI BioScience
Potato tuber infected by R. solanacearum (natural infection) showing droplets of bacterial slime oozing from the eyes and clumps of soil sticking to this slime.
TitleInfected potato tuber
CaptionPotato tuber infected by R. solanacearum (natural infection) showing droplets of bacterial slime oozing from the eyes and clumps of soil sticking to this slime.
Copyright©Plant Protection Service
Potato tuber infected by R. solanacearum (natural infection) showing droplets of bacterial slime oozing from the eyes and clumps of soil sticking to this slime.
Infected potato tuberPotato tuber infected by R. solanacearum (natural infection) showing droplets of bacterial slime oozing from the eyes and clumps of soil sticking to this slime.©Plant Protection Service
Left: early symptoms of brown rot in a potato tuber caused by R. solanacearum (natural infection); note vascular browning and drops of bacterial slime.
Right: advanced symptoms of brown rot in a potato tuber (natural infection); note vascular browning and drops of bacterial slime. A blackish soft rot, caused by secondary organisms has already started.
TitleSymptoms
CaptionLeft: early symptoms of brown rot in a potato tuber caused by R. solanacearum (natural infection); note vascular browning and drops of bacterial slime. Right: advanced symptoms of brown rot in a potato tuber (natural infection); note vascular browning and drops of bacterial slime. A blackish soft rot, caused by secondary organisms has already started.
Copyright©Plant Protection Service
Left: early symptoms of brown rot in a potato tuber caused by R. solanacearum (natural infection); note vascular browning and drops of bacterial slime.
Right: advanced symptoms of brown rot in a potato tuber (natural infection); note vascular browning and drops of bacterial slime. A blackish soft rot, caused by secondary organisms has already started.
SymptomsLeft: early symptoms of brown rot in a potato tuber caused by R. solanacearum (natural infection); note vascular browning and drops of bacterial slime. Right: advanced symptoms of brown rot in a potato tuber (natural infection); note vascular browning and drops of bacterial slime. A blackish soft rot, caused by secondary organisms has already started.©Plant Protection Service
Potato stem infected with R. solanacearum (natural infection). Stem has been cut and placed in a beaker of water; threads of bacterial slime ooze out of the vascular bundles.
TitleBacterial slime
CaptionPotato stem infected with R. solanacearum (natural infection). Stem has been cut and placed in a beaker of water; threads of bacterial slime ooze out of the vascular bundles.
Copyright©Plant Protection Service
Potato stem infected with R. solanacearum (natural infection). Stem has been cut and placed in a beaker of water; threads of bacterial slime ooze out of the vascular bundles.
Bacterial slimePotato stem infected with R. solanacearum (natural infection). Stem has been cut and placed in a beaker of water; threads of bacterial slime ooze out of the vascular bundles. ©Plant Protection Service
Light micrograph of cells of R. solanacearum in and around a spiral vessel of potato. Gram stain.
TitleCells in potato
CaptionLight micrograph of cells of R. solanacearum in and around a spiral vessel of potato. Gram stain.
Copyright©J.D. Janse
Light micrograph of cells of R. solanacearum in and around a spiral vessel of potato. Gram stain.
Cells in potatoLight micrograph of cells of R. solanacearum in and around a spiral vessel of potato. Gram stain.©J.D. Janse

Identity

Top of page

Preferred Scientific Name

  • Ralstonia solanacearum (Smith 1896) Yabuuchi et al. 1996

Preferred Common Name

  • bacterial wilt of potato

Other Scientific Names

  • Bacillus musae Rorer 1911
  • Bacillus musarum Zeman 1921
  • Bacillus nicotianae Uyeda 1904
  • Bacillus sesami Malkoff 1906
  • Bacillus solanacearum Smith 1896
  • Bacterium solanacearum (Smith) Chester 1897
  • Bacterium solanacearum var. asiatica (Smith) Magrou 1937
  • Bacterium solanacearum var. asiaticum Smith 1914
  • Burkholderia solanacearum (Smith 1896) Yabuuchi et al. 1992
  • Chromobacterium nicotianae (Uyeda) Krasil'nikov 1949
  • Erwinia nicotianae (Uyeda) Bergey et al. 1923
  • Erwinia solanacearum (Smith) Holland 1920
  • Phytobacterium solanacearum (Smith) Patel & Kulkarni 1951
  • Phytomonas ricini Archibald 1927
  • Phytomonas solanacearum (Smith) Bergey et al. 1923
  • Phytomonas solanacearum var. asiatica (Smith) Stapp 1928
  • Pseudomonas batatae Cheng & Faan 1962
  • Pseudomonas ricini (Archibald) Robbs 1954
  • Pseudomonas solanacearum (Smith 1896) Smith 1914
  • Pseudomonas solanacearum var. asiatica (Smith) 1928
  • Pseudomonas tectonae Roldan & Andres 1953
  • Xanthomonas solanacearum (Smith) Dowson 1943
  • Xanthomonas solanacearum var. asiatica (Smith) Elliott 1951

International Common Names

  • English: bacterial wilt; bacterial wilt of solanaceous crops; bacterial wilt of teak; brown rot of potato; brown rot of solanaceous crops; granville wilt of tobacco; moko disease: banana; seedling rot; slime disease: potato; southern bacterial blight of tomato
  • Spanish: marchitez bacteriana; marchitez del platano; marchitez del tomate; moco del platano; podredumbre parda de la patata; vaquita de la papa
  • French: bactériose vasculaire; bactériose vasculaire de la pomme de terre; flétrissement bactérien de la pomme de terre; flétrissement bactérien de la pomme de terre; flétrissement bactérien de la tomate; flétrissement bactérien des solanacées; flétrissement bactérien du bananier; flétrissement bactérien du tabac; maladie de moko du bananier; pourriture brune

Local Common Names

  • Germany: Bakterienwelke; Braunfäule der Kartoffel; Schleimkrankheit

Summary of Invasiveness

Top of page

Ralstonia solanacearum is included in the A2 (high risk) list of quarantine organisms by the European and Mediterranean Plant Protection Organization (EPPO). EPPO Code for R. solanacearum is RALSSO, while the phytosanitary categorization of the species in EPPO A2 list is no.58, EU: I/A2 (EPPO, 2018). Bacterial wilt disease was first reported in southern USA in the late nineteenth century on tomato plants (Smith, 1896). Infected plant materials (e.g. potato tubers) transmit the pathogen over long distances; hence, quarantine inspections and plant sanitary practices are the cornerstone of disease management (EPPO, 2018). R. solanacearum strains in the race 3 group are a select agent under the US Agricultural Bioterrorism Protection Act of 2002 (USDA, 2005). Peculiarly, the organism, if not yet already present in North America in pelargonium (Strider et al., 1981), was introduced with cuttings of this host by American companies producing these cuttings for their markets in countries like Kenya and Guatemala (Norman et al., 1999, 2009; Kim et al., 2002; Williamson et al., 2002; O'Hern, 2004). A similar situation led to introductions of the pathogen from Kenya into some northern European nurseries. Once the source (contaminated surface water) was recognized and proper control measures (use of deep soil water, disinfection of cutting producing premises and replacement of mother stock), the problem was solved and the disease in greenhouses eradicated (Janse et al., 2004). Similarly race 1 has been introduced into greenhouses with ornamental plants (rhizomes, cuttings or fully grown plants) such as Epipremnum, Anthurium, Curcuma spp. and Begonia eliator from tropical areas (Norman and Yuen, 1998, 1999; Janse et al., 2006; Janse, 2012). Introduction can and did occur from Costa Rica and the Caribbean, Indonesia, Thailand and South Africa. However, this idea of placing pathogens on bioterrorist list for unclear and perhaps industry-driven reasons and its effects, is strongly opposed in a recent publication from leading phytobacteriologists. This is because R. solanacearum is an endemic pathogen, causing endemic disease in most parts of its geographic occurrence, moreover normal quarantine regulations are already in place where the disease is not present or only sporadically and are thought to be more efficient and less damaging to trade and research than placing this pathogen on select agent lists and treating it as such (Young et al., 2008). Peculiarly, it has been used in the control of a real invasive species, the weed kahili ginger (Hedychium gardenarium) in tropical forests in Hawaii. This is not without risks because strains occurring on this weed host were thought to be non-virulent, but later appeared to be virulent on many edible and ornamental ginger species as well (Anderson and Gardner, 1999; Paret et al., 2008). Another threat for these countries could be strains belonging to race 1, biovar 1 (phylotype I) that have already been reported from field-grown potatoes in Portugal (Cruz et al., 2008).

Taxonomic Tree

Top of page
  • Domain: Bacteria
  •     Phylum: Proteobacteria
  •         Class: Betaproteobacteria
  •             Order: Burkholderiales
  •                 Family: Ralstoniaceae
  •                     Genus: Ralstonia
  •                         Species: Ralstonia solanacearum

Notes on Taxonomy and Nomenclature

Top of page

Ralstonia solanacearum was originally included in the Approved Lists (Skerman et al., 1980) as Pseudomonas solanacearum, the name already given by Erwin Smith in 1914. In a comparative study of non-fluorescent species of the genus Pseudomonas, Yabuuchi et al. (1992) proposed the transfer of P. solanacearum and related non-fluorescent pseudomonads to a novel genus, Burkholderia, and the bacterial wilt pathogen was renamed as B. solanacearum. A subsequent study of this genus a few years later indicated that B. solanacearum was sufficiently distinct from other members of the genus to warrant assignment to the newly proposed genus, Ralstonia (Yabuuchi et al., 1995) with the closely related plant pathogenic species, Ralstonia syzygii, causal agent of Sumatra disease of clove tree (Syzygium aromaticum) and the distinct Blood Disease Bacterium, causal agent of blood disease of banana in Indonesia (now classified as Ralstonia haywardii subspecies celebensis, see below).

Ralstonia solanacearum comprises sub-populations variously reported as groups, races, biovars, biotypes, sub-races and strains. The commonly applied terms biovar and biotype refer to differences in biochemical and phage reactions (Hayward, 1962). Races, distinguished on the basis of differences in plant host range (Buddenhagen et al., 1962), are usually referred to in this text.

At the end of the nineteenth century a severe wilting disease (called 'slime disease') was described in (sub)tropical regions on tomato, tobacco, potato, banana and groundnut. The founder of phytobacteriology, Erwin F. Smith, had already proved in 1896 that the causal organism was a bacterium (named by him as Bacillus solanacearum). In 1914 Smith placed this non-spore forming, Gram-negative bacterium in the genus Pseudomonas. In the following years 'slime disease' proved to be present in many different hosts in (sub)tropical regions. However, Moraes (1947) described a variant of the bacterium in Portugal that was better adapted to temperate climatic regions (growth optimum of 27 instead of 35ºC). This variant was also found later in other Mediterranean countries, especially Egypt, and in mountainous areas in the tropics (Janse, 1996). This 'cold' variant and the variant on banana could be easily discriminated on the basis of pathogenicity to different hosts (classification into races) and the use of carbon sources in the laboratory (biochemical varieties or biovars). The tropical variant with a very broad host range was classified by Buddenhagen et al. (1962) as race 1 (from which later Race 4 and 5 were separated), the variant specialised on banana and the related Heliconia species, Race 2, and the 'cold' variant with a restricted host range, mainly Solanaceae, race 3. The 'cold' variant (race 3) appeared to belong to biovar 2 (later also named 2A) in the biochemical classification of Hayward (see Hayward, 1994), whereas the other races contained biovars 1 and 3-5. A special biovar (2T or 2N) of race 3 occurs in the Andes, and in this area resistance against race 3 was also found in wild potato. Moreover, once studied, strains from highland cultivation of potato and tomato in South and North America are usually Race 3, biovar 2 = Phylotype IIB sequevar 1, see below (Janse, 1996; Janse et al., 2004; Perez et al., 2008; Siri et al., 2011). This led to the presumption that Race 3, biovar 2 has spread from the Andes region with potato, perhaps especially during the second World War with allied troops, to the Mediterranean area (Janse, 1996; Cellier and Prior, 2010; Wicker et al., 2011). Race 3, biovar 2 appears to be genetically very homogeneous.

Further molecular-biological/taxonomic investigations have enabled a more refined classification of Rsol, e.g., on the basis of Restriction Fragment Length Polymorphism (RFLP)- and 16S rRNA-analysis and sequence-analysis of the endonuclease (egl) gene and other household genes (Cook and Sequeira, 1994; van der Wolf et al., 1998; Saddler et al., 1998; Poussier et al., 2000; Timms-Wilson et al., 2001; Fegan and Prior, 2005; Gabriel et al., 2006; Castillo and Greenberg, 2007; Pingsheng et al., 2007). On the basis of sequence analysis, four phylotypes are discriminated: Phylotype I contains strains from Asia, phylotype II from the American continent (IIB holds the Race 3, biovar 2 strains (sequevar 1), IIA other strains, e.g., from Musa and tomato, also some from Africa), phylotype III (holds biovars 1 and 2T from Africa, and phylotype IV (holds biovars 1, 2 and 2T and also the closely related R. syzygii and the blood disease bacterium (BDB). Strains of this phylotype originate from Indonesia, Japan and Australia (Fegan and Prior, 2005, 2006; Wicker et al., 2007, 2009, 2011). A new aggressive variant (phylotype II/4NPB = non-pathogenic to banana) with many hosts, including Anthurium, Cucurbitaceae and tomato, was recently described from Martinique (Wicker et al., 2007, 2009). This phylotype could be a threat for European greenhouse cultivation and was already reported from France (Cellier and Prior 2010). Currently, IIB/4NPB is widely established in French Guiana and it has been suggested that this phylotype/ecotype may have originated from the Amazonian region and spread throughout the Caribbean region (Deberdt et al., 2014). The 'cold' form (Race 3, biovar 2 or R3b2) that occurred/occurs in many European countries (Janse, 1996; EPPO Global Database) is in the recent typing studies genetically very homogenous and has always been classified until now as Ralstonia solanacearum (Rsol) R3b2, phylotype IIB (sequevar 1 and 2). This homogeneity was recently also confirmed from China (Xu et al., 2009; Xue et al., 2011).

In a recent whole genome sequencing taxonomic study by Remenant et al. (2011), the following important taxonomic and nomenclatorial changes have been proposed:

Phylotypes I and III strains appear to form a unique genomic species, for which the name Ralstonia sequeirae is proposed, with type strain GM I1000; Phylotype II strains, including the original Rsol type strain K60T, are maintained as R. solanacearum; Phylotype IV strains, including those of R. syzygii and the BLDB strains also form a genomic species, for which R. haywardii, with type strain PSI07, where the broad host range strains are designated R. haywardii subspecies solanacearum with type strain PSI07, the BLDB strains as R. haywardii subspecies celebensis with type strain R229 and the R. syzygii that are insect-transmitted by tube-building Hindola spp. cercopoids, as R. haywardii subspecies syzygii.

Recently, reclassification of R. solanacearum species complex into three species was proposed; thereby, only the phylotype II strains remained as R. solanacearum, while the phylotypes I and III strains were designated as R. pseudosolanacearum, and the phylotype IV strains were divided into three sub-species of R. syzygii, i.e., R. syzygii subsp. syzygii, R. syzygii subsp. celebensis and R. syzygii subsp. indonesiensis (Safni et al., 2014; Prior et al., 2016).

Description

Top of page

R. solanacearum is a Gram-negative bacterium with rod-shaped cells, 0.5-1.5 µm in length, with a single, polar flagellum. The positive staining reaction for poly-ß-hydroxybutyrate granules with Sudan Black B or Nile Blue distinguishes R. solanacearum from many other (phytopathogenic) Gram-negative bacterial species. Gram-negative rods with a polar tuft of flagella, non-fluorescent but diffusible brown pigment often produced. Polyhydroxybutyrate (PHB) is accumulated as cellular reserve and can be detected by Sudan Black staining on nutrient-rich media or the Nile Blue test, also in smears from infected tissues (Anonymous, 1998; 2006) On the general nutrient media, virulent isolates of R. solanacearum develop pearly cream-white, flat, irregular and fluidal colonies often with characteristic whorls in the centre. Avirulent forms of R. solanacearum form small, round, non-fluidal, butyrous colonies which are entirely cream-white. On Kelman’s tetrazolium and SMSA media, the whorls are blood red in colour. Avirulent forms of R. solanacearum form small, round, non-fluidal, butyrous colonies which are entirely deep red.

Distribution

Top of page

R. solanacearum is widespread in tropical, subtropical and warm temperate areas throughout the world. Its occurrence has also been reported from temperate zones. In particular, race 3 which was described by Moraes in 1947 from Portugal, was first found to spread in the Mediterranean basin, whereafter further spread took place with importation of infected early potatoes from that area, where brown rot was causing problems, most notably in Egypt. Further spread occurred through irrigation, especially in the 1980s and 1990s when irrigation in potato in northern Europe became more common to raise production and the possibility of controlling potato scab (Janse, 1996, 2012).

Many older host records (of Pseudomonas solanacearum) were made without deposition of host reference strains and these cannot now be allocated to a particular race. It will only be possible to make allocations when further isolates from hosts are obtained and characterized.

Distribution Table

Top of page

The distribution in this summary table is based on all the information available. When several references are cited, they may give conflicting information on the status. Further details may be available for individual references in the Distribution Table Details section which can be selected by going to Generate Report.

Last updated: 25 Feb 2021
Continent/Country/Region Distribution Last Reported Origin First Reported Invasive Reference Notes

Africa

AlgeriaAbsent, Formerly present
AngolaPresent
BeninPresent, Widespread
Burkina FasoPresent
BurundiPresent
CameroonPresent, Widespread
Congo, Democratic Republic of thePresent
Congo, Republic of thePresent
Côte d'IvoirePresent
EgyptPresent
EswatiniPresent
EthiopiaPresent
GabonAbsent, Unconfirmed presence record(s)
GambiaPresent
GhanaPresent
KenyaPresent
LesothoPresent
LibyaPresent
MadagascarPresent
MalawiPresent, Widespread
MaliPresent, Widespread
MauritiusPresent
MoroccoPresent
MozambiqueAbsent, Unconfirmed presence record(s)
NigeriaPresent
RéunionPresent
RwandaPresent
SenegalPresent
SeychellesAbsent, Unconfirmed presence record(s)
Sierra LeonePresent
SomaliaPresent
South AfricaPresent, Widespread
TanzaniaPresent
UgandaPresent
ZambiaPresent
ZimbabwePresent, Localized

Asia

ArmeniaAbsent, Invalid presence record(s)
BangladeshPresent, Widespread
BhutanPresent
BruneiPresent
CambodiaPresent
ChinaPresent, Localized
-AnhuiPresent
-BeijingPresent, Few occurrences
-ChongqingPresent
-FujianPresent, Widespread
-GansuPresent, Few occurrences
-GuangdongPresent, Widespread
-GuangxiPresent, Widespread
-GuizhouPresent
-HainanPresent
-HebeiPresent
-HenanPresent
-HubeiPresent
-HunanPresent, Widespread
-JiangsuPresent
-JiangxiPresent
-JilinPresent, Few occurrences
-LiaoningPresent, Few occurrences
-NingxiaPresent, Few occurrences
-QinghaiPresent, Few occurrences
-ShaanxiPresent, Few occurrences
-ShandongPresent
-ShanghaiPresent, Few occurrences
-ShanxiPresent
-SichuanPresent, Widespread
-XinjiangPresent, Few occurrences
-YunnanPresent
-ZhejiangPresent
GeorgiaPresent, Localized
Hong KongPresent, Few occurrences
IndiaPresent, Widespread
-Andaman and Nicobar IslandsPresent
-Andhra PradeshPresent
-Arunachal PradeshPresent, Widespread
-AssamPresent
-BiharPresent
-GoaPresent
-GujaratPresent
-Himachal PradeshPresent
-JharkhandPresent
-KarnatakaPresent
-KeralaPresent
-Madhya PradeshPresent
-MaharashtraPresent
-ManipurPresent
-MeghalayaPresent
-MizoramPresent
-NagalandPresent
-OdishaPresent
-PunjabPresent
-Tamil NaduPresent
-TripuraPresent
-Uttar PradeshPresent
-UttarakhandPresent
-West BengalPresent
IndonesiaPresent
-Irian JayaPresent
-JavaPresent
-SulawesiPresent
-SumatraPresent
IranPresent, Widespread
JapanPresent
-HonshuPresent
-KyushuPresent
LaosPresent
LebanonAbsent, Formerly present
MalaysiaPresent, Widespread
-Peninsular MalaysiaPresent
-SabahPresent
-SarawakPresent
MyanmarPresent
NepalPresent, Few occurrences
North KoreaPresent
PakistanPresent
PhilippinesPresent
Saudi ArabiaPresent
SingaporePresent
South KoreaPresent
Sri LankaPresent
TaiwanPresent, Widespread
ThailandPresent
TurkeyPresent
VietnamPresent

Europe

AustriaAbsent, Eradicated
BelgiumPresent, Few occurrences
BulgariaAbsent, Formerly present
CzechiaPresent, Transient under eradication
DenmarkAbsent, Intercepted only
EstoniaAbsent, Confirmed absent by survey
FinlandAbsent, Confirmed absent by survey
FrancePresent, Few occurrences
GermanyPresent, Few occurrences
GreecePresent, Few occurrences
HungaryPresent, Few occurrences
ItalyAbsent, Eradicated
-SardiniaAbsent, Eradicated
LatviaAbsent, Confirmed absent by survey
LithuaniaAbsent, Confirmed absent by survey
MaltaAbsent, Confirmed absent by survey
MoldovaPresent
NetherlandsPresent, LocalizedIntroduced1992
PolandPresent, Few occurrences
PortugalPresent
RomaniaPresent, Few occurrences
RussiaPresent, Few occurrences
-Central RussiaPresent, Few occurrences
-Eastern SiberiaAbsent, Unconfirmed presence record(s)
-Russian Far EastAbsent, Unconfirmed presence record(s)
-Southern RussiaAbsent, Unconfirmed presence record(s)
SerbiaPresent
SlovakiaPresent, Few occurrences
SloveniaAbsent, Eradicated
SpainPresent, Few occurrences
SwedenAbsent, Eradicated
SwitzerlandAbsent, Eradicated
UkrainePresent, Transient under eradication
United KingdomPresent, Transient under eradication

North America

BelizePresent, Widespread
CanadaAbsent, Formerly present
-OntarioAbsent, Formerly present
Costa RicaPresent
CubaPresent
DominicaAbsent, Unconfirmed presence record(s)
Dominican RepublicPresent
El SalvadorPresent
GrenadaPresent, Few occurrences
GuadeloupePresent
GuatemalaPresent
HaitiAbsent, Unconfirmed presence record(s)
HondurasPresent
JamaicaAbsent, Unconfirmed presence record(s)
MartiniquePresent, Widespread
MexicoPresent, Localized
NicaraguaPresent
PanamaPresent
Puerto RicoAbsent, Unconfirmed presence record(s)
Saint LuciaAbsent, Unconfirmed presence record(s)
Saint Vincent and the GrenadinesPresent, Widespread
Trinidad and TobagoPresent, Widespread
United StatesPresent, Widespread
-AlabamaPresent
-ArkansasPresent
-ConnecticutPresent, Only undercover/indoors
-DelawarePresent
-FloridaPresent
-GeorgiaPresent
-HawaiiPresent
-IllinoisPresent
-IndianaPresent
-LouisianaPresent
-MichiganPresent
-New HampshirePresent
-New JerseyPresent
-New YorkAbsent, Eradicated
-North CarolinaPresent
-PennsylvaniaPresent, Localized
-South CarolinaPresent
-South DakotaPresent
-WisconsinPresent

Oceania

American SamoaAbsent, Unconfirmed presence record(s)
AustraliaPresent, Localized
-New South WalesPresent
-Northern TerritoryPresent
-QueenslandPresent
-South AustraliaPresent
-VictoriaPresent
-Western AustraliaAbsent, Formerly present
Cook IslandsPresent
Federated States of MicronesiaPresent
FijiPresent
French PolynesiaPresent
GuamPresent
New CaledoniaPresent, Localized
New ZealandPresent, Widespread
Papua New GuineaPresent
SamoaPresent
TongaPresent
VanuatuPresent

South America

ArgentinaAbsent, Invalid presence record(s)
BoliviaPresent
BrazilPresent
-AcrePresent
-AlagoasPresent
-AmapaPresent
-AmazonasPresent
-BahiaPresent
-CearaPresent
-Espirito SantoPresent
-GoiasPresent
-MaranhaoPresent
-Mato GrossoPresent
-Minas GeraisPresent
-ParaPresent
-ParanaPresent
-PernambucoPresent
-PiauiPresent
-Rio de JaneiroPresent
-Rio Grande do SulPresent
-RondoniaPresent
-RoraimaPresent
-Santa CatarinaPresent
-Sao PauloPresent
-SergipePresent
-TocantinsPresent
ChilePresent, Localized
ColombiaPresent
EcuadorPresent, Localized
French GuianaPresent
GuyanaPresent
ParaguayPresent, Localized
PeruPresent
SurinamePresent
UruguayPresent, Widespread
VenezuelaPresent

Risk of Introduction

Top of page

Risk Criteria Category

Economic Importance: High
Distribution: Worldwide
Seedborne Incidence: Moderate
Seed Transmitted: Yes (in some species, e.g. groundnut)
Seed Treatment: Yes

Notes on Phytosanitary Risk

R. solanacearum is an EPPO A2 quarantine organism (OEPP/EPPO, 1978; EPPO, 2018) and is listed by APPPC and IAPSC. The occurrence of different races and strains of the pathogen with varying virulence under different environmental conditions presents a serious danger to European and Mediterranean potato and tomato production. Absence of the bacterium is an important consideration for countries exporting seed potatoes. Hosts other than potato are most likely to be affected in the warmer parts of the EPPO region, where the bacterium already occurs. However, even in these areas, races other than race 3 have not been positively identified, and the introduction of races not occurring in the region could have a great economic impact. For example, banana strains are not found in the banana-producing areas of the southern Mediterranean zone, and virtually have A1 quarantine status. Race 3 (biovar 2) appears to present the most important risk for the EPPO region as a whole because it may be introduced and spread in infected early ware potatoes or seed potatoes. The importation of infected potatoes for cattle fodder or for food or industrial processing may result in the escape of the pathogen. Race 1 strains introduced with planting material may also result in losses if restrictive and severe quarantine measures are applied, for example, in greenhouse production in cooler climates when the pathogen is introduced with planting material, e.g. Curcuma rhizomes (Tuin et al., 1996).

Habitat List

Top of page
CategorySub-CategoryHabitatPresenceStatus
Terrestrial ManagedCultivated / agricultural land Secondary/tolerated habitat Harmful (pest or invasive)
Terrestrial ManagedProtected agriculture (e.g. glasshouse production) Secondary/tolerated habitat Harmful (pest or invasive)
Terrestrial ManagedManaged forests, plantations and orchards Secondary/tolerated habitat Harmful (pest or invasive)
Terrestrial ManagedManaged grasslands (grazing systems) Secondary/tolerated habitat Harmful (pest or invasive)
Terrestrial Natural / Semi-naturalNatural forests Secondary/tolerated habitat Harmful (pest or invasive)
Terrestrial Natural / Semi-naturalNatural grasslands Secondary/tolerated habitat Harmful (pest or invasive)
Terrestrial Natural / Semi-naturalCold lands / tundra Secondary/tolerated habitat Harmful (pest or invasive)

Hosts/Species Affected

Top of page

The Ralstonia solanacearum complex species (i.e., the newly described species R. pseudosolanacearum and R. syzygii; Safni et al., 2014) has an extremely wide host range, but different pathogenic varieties (races) within the species may show more restricted host ranges. Over 250 species, especially tropical and subtropical crops, are susceptible to one or other of the races of R. solanacearum species complex. Worldwide, the most important are: tomato, tobacco, aubergine, potato, banana, plantain and Heliconia. Within the EPPO region, race 3 (see Biology and Ecology) with a limited host range including potato, tomato and the weed Solanum dulcamara, is considered to have potential for spread. Recently, Lopes and Rossato (2018) provided an overview on the distribution and host range of R. solanacearum in Brazil, considered as one of the hypothetical centres of origin of the pathogen.

Other host crops are: Anthurium spp., groundnut, Capsicum annuum, cotton, rubber, sweet potato, cassava, castor bean and ginger. Many weeds are alternative hosts of the pathogen. Solanum cinereum in Australia (Graham and Lloyd, 1978), Solanum nigrum and, in rare cases, Galinsoga parviflora, G. ciliata, Polygonum capitata, Portulaca oleracea (for example, in Nepal; Pradhanang and Elphinstone, 1996a) and Urtica dioica have been reported as weed hosts for race 3 (Wenneker et al., 1998). Solanum nigrum and S. dulcamara are primary wild hosts for race 3.

Several lists have been recorded for the host plants of R. solanacearum (Kelman, 1953; Bradbury, 1986; Persley, 1986; Hayward, 1994a). However, the original reports gathered over many years vary greatly in reliability. Few reference strains from reported host plants have been deposited in publicly accessible culture collections to support the authenticity of records.

Host Plants and Other Plants Affected

Top of page
Plant nameFamilyContextReferences
Ageratum conyzoides (billy goat weed)AsteraceaeWild host
    Amomum subulatum (large cardamom)ZingiberaceaeOther
      Annona cherimola (cherimoya)AnnonaceaeMain
        AnthuriumAraceaeOther
          Arachis hypogaea (groundnut)FabaceaeMain
            Artemisia (wormwoods)AsteraceaeOther
              Beta vulgaris (beetroot)ChenopodiaceaeOther
                Beta vulgaris var. ciclaChenopodiaceaeOther
                  Bougainvillea glabraNyctaginaceaeOther
                    Capsicum annuum (bell pepper)SolanaceaeOther
                      Casuarina cunninghamiana (Australian beefwood)CasuarinaceaeMain
                        Casuarina equisetifolia (casuarina)CasuarinaceaeMain
                          Casuarina glauca (scaly oak (Australia))CasuarinaceaeMain
                            Cereus peruvianusCactaceaeOther
                              Cestrum nocturnum (night jessamine)SolanaceaeOther
                                Chenopodium (Goosefoot)ChenopodiaceaeOther
                                  Citrullus lanatus (watermelon)CucurbitaceaeOther
                                    Coffea arabica (arabica coffee)RubiaceaeOther
                                      ColeusLamiaceaeOther
                                        Coleus forskohliiLamiaceaeOther
                                          Colocasia esculenta (taro)AraceaeOther
                                            Corchorus olitorius (jute)TiliaceaeOther
                                              Cosmos bipinnatus (garden cosmos)AsteraceaeOther
                                                Cucumis melo (melon)CucurbitaceaeOther
                                                  Cucumis sativus (cucumber)CucurbitaceaeOther
                                                    Cucurbita maxima (giant pumpkin)CucurbitaceaeOther
                                                      Cucurbita moschata (pumpkin)CucurbitaceaeOther
                                                        Cucurbita pepo (marrow)CucurbitaceaeOther
                                                          Curcuma alismatifoliaZingiberaceaeOther
                                                            Curcuma longa (turmeric)ZingiberaceaeOther
                                                              Cynara cardunculus var. scolymus (globe artichoke)AsteraceaeOther
                                                                Cyphomandra betacea (tree tomato)SolanaceaeOther
                                                                  Datura stramonium (jimsonweed)SolanaceaeOther
                                                                    Emilia sonchifolia (red tasselflower)AsteraceaeOther
                                                                      EucalyptusMyrtaceaeOther
                                                                        Eupatorium cannabinumAsteraceaeOther
                                                                          Galinsoga parviflora (gallant soldier)AsteraceaeWild host
                                                                            Galinsoga quadriradiata (shaggy soldier)AsteraceaeWild host
                                                                              Gossypium (cotton)MalvaceaeOther
                                                                                HeliconiaHeliconiaceaeMain
                                                                                  Heliconia caribaeaHeliconiaceaeOther
                                                                                    Hevea brasiliensis (rubber)EuphorbiaceaeOther
                                                                                      Ipomoea batatas (sweet potato)ConvolvulaceaeOther
                                                                                        Justicia adhatoda (Malabar nut)AcanthaceaeOther
                                                                                          Lagenaria siceraria (bottle gourd)CucurbitaceaeOther
                                                                                            Maranta arundinacea (arrowroot)MarantaceaeOther
                                                                                              Medicago trunculata (barrel medic)FabaceaeOther
                                                                                                Momordica charantia (bitter gourd)CucurbitaceaeOther
                                                                                                  Musa (banana)MusaceaeMain
                                                                                                    Musa x paradisiaca (plantain)MusaceaeMain
                                                                                                      Nicotiana rustica (wild tobacco)SolanaceaeOther
                                                                                                        Nicotiana tabacum (tobacco)SolanaceaeMain
                                                                                                          Olea europaea subsp. europaea (European olive)OleaceaeOther
                                                                                                            Pelargonium (pelargoniums)GeraniaceaeOther
                                                                                                              Pelargonium hortorumGeraniaceaeOther
                                                                                                                Pelargonium zonale hybridsGeraniaceaeOther
                                                                                                                  Physalis (Groundcherry)SolanaceaeOther
                                                                                                                    Physalis angulata (cutleaf groundcherry)SolanaceaeOther
                                                                                                                      Platostoma chinensisLamiaceaeOther
                                                                                                                        Plectranthus barbatusLamiaceaeOther
                                                                                                                          Pogostemon cablin (patchouli)LamiaceaeOther
                                                                                                                            Polygonum capitatum (pinkhead smartweed)PolygonaceaeWild host
                                                                                                                              Portulaca oleracea (purslane)PortulacaceaeWild host
                                                                                                                                Ricinus communis (castor bean)EuphorbiaceaeOther
                                                                                                                                  Rosa (roses)RosaceaeOther
                                                                                                                                    Salpiglossis sinuataSolanaceaeOther
                                                                                                                                      Salvia reflexaLamiaceaeOther
                                                                                                                                        Siraitia grosvenoriiCucurbitaceaeOther
                                                                                                                                          Solanum capsicastrumSolanaceaeOther
                                                                                                                                            Solanum carolinense (horsenettle)SolanaceaeOther
                                                                                                                                              Solanum cinereumSolanaceaeWild host
                                                                                                                                                Solanum dulcamara (bittersweet nightshade)SolanaceaeOther
                                                                                                                                                  Solanum luteumSolanaceaeOther
                                                                                                                                                    Solanum lycopersicum (tomato)SolanaceaeMain
                                                                                                                                                      Solanum melongena (aubergine)SolanaceaeMain
                                                                                                                                                        Solanum nigrum (black nightshade)SolanaceaeWild host
                                                                                                                                                          Solanum phurejaSolanaceaeOther
                                                                                                                                                            Solanum sisymbriifolium (sticky nightshade)SolanaceaeOther
                                                                                                                                                              Solanum tuberosum (potato)SolanaceaeMain
                                                                                                                                                                Soliva anthemifoliaAsteraceaeOther
                                                                                                                                                                  Strelitzia reginae (Queens bird-of-paradise)StrelitziaceaeOther
                                                                                                                                                                    Tagetes (marigold)AsteraceaeOther
                                                                                                                                                                      Tagetes erecta (Mexican marigold)AsteraceaeOther
                                                                                                                                                                        Talinum fruticosumPortulacaceaeOther
                                                                                                                                                                          Tectona grandis (teak)LamiaceaeMain
                                                                                                                                                                            Urtica dioica (stinging nettle)UrticaceaeWild host
                                                                                                                                                                              Verbena brasiliensisVerbenaceaeOther
                                                                                                                                                                                Washingtonia filifera (desert fanpalm)ArecaceaeOther
                                                                                                                                                                                  Zingiber officinale (ginger)ZingiberaceaeMain

                                                                                                                                                                                    Growth Stages

                                                                                                                                                                                    Top of page
                                                                                                                                                                                    Vegetative growing stage

                                                                                                                                                                                    Symptoms

                                                                                                                                                                                    Top of page

                                                                                                                                                                                    Potato

                                                                                                                                                                                    Foliage: the first visible symptom is a wilting of the leaves at the ends of the branches during the heat of the day with recovery at night. As the disease develops, a streaky brown discoloration of the stem may be observed on stems 2.5 cm or more above the soil line, and the leaves develop a bronze tint. Epinasty of the petioles may occur. Subsequently, plants fail to recover and die. A white, slimy mass of bacteria exudes from vascular bundles when broken or cut.

                                                                                                                                                                                    Tubers: external symptoms may or may not be visible, depending on the state of development of the disease. Bacterial ooze often emerges from the eyes and stem-end attachment of infected tubers. When this bacterial exudate dries, soil masses adhere to the tubers giving affected tubers a 'smutty' appearance. Cutting the diseased tuber will reveal browning and necrosis of the vascular ring and in adjacent tissues. A creamy fluid exudate usually appears spontaneously on the vascular ring of the cut surface.

                                                                                                                                                                                    Atypical symptoms on potato (necrotic spots on the epidermis), possibly caused after lenticel infection, have been described by Rodrigues-Neto et al. (1984).

                                                                                                                                                                                    Symptoms of brown rot may be readily distinguished with those of ring rot caused by Clavibacter sepedonicus (EPPO/CABI, 1997). R. solanacearum can be distinguished by the bacterial ooze that often emerges from cut stems and from the eyes and stem-end attachment of infected tubers. If cut tissue is placed in water, threads of ooze are exuded. Because such threads are not formed by other pathogens of potato, this test is of presumptive diagnostic value. For ring rot, tubers must be squeezed to press out yellowish dissolved vascular tissue and bacterial slime.

                                                                                                                                                                                    Tomato

                                                                                                                                                                                    The youngest leaves are the first to be affected and have a flaccid appearance, usually at the warmest time of day. Wilting of the whole plant may follow rapidly if environmental conditions are favourable for the pathogen. Under less favourable conditions, the disease develops slowly, stunting may occur and large numbers of adventitious roots are produced on the stem. The vascular tissues of the stem show a brown discoloration and drops of white or yellowish bacterial ooze may be released if the stem is cut (McCarter, 1991).

                                                                                                                                                                                    Tobacco

                                                                                                                                                                                    One of the distinctive symptoms is partial wilting and premature yellowing of leaves. Leaves on one side of the plant or even a half leaf may show wilting symptoms. This occurs because vascular infection may be restricted to limited sectors of stems and leaf petioles. In severe cases, leaves wilt rapidly without changing colour and stay attached to the stem. As in tomato, the vascular tissues show a brown discoloration when cut. The primary and secondary roots may become brown to black (Echandi, 1991).

                                                                                                                                                                                    Banana

                                                                                                                                                                                    On young and fast-growing plants, the youngest leaves turn pale green or yellow and collapse. Within a week all leaves may collapse. Young suckers may be blackened, stunted or twisted. The pseudostems show brown vascular discoloration (Hayward, 1983). Moko disease, caused by R. solanacearum, is easily confused with the disease caused by Fusarium oxysporum f.sp. cubense. A clear distinction is possible when fruits are affected - a brown and dry rot is only seen in Moko disease.

                                                                                                                                                                                    Teak

                                                                                                                                                                                    Seedling wilt manifests itself as yellowing of the mature lower leaves, which show scorching and browning of the tissue between the veins. The younger leaves and terminal shoot become flaccid and droop. Affected seedlings show either a gradual loss of leaf turgidity or sudden wilting. Seedling wilt becomes evident in the early hours of the day and gradually becomes more pronounced by midday, especially on sunny days. The wilted seedlings may partially recover during the afternoon and evening when temperatures fall, but wilting becomes more pronounced on successive days. The roots of affected seedlings exhibit a brownish-black discoloration. In advanced stages of disease, the tuberous portion of the root becomes discoloured and spongy. In due course, seedlings with pronounced wilt symptoms become completely desiccated.

                                                                                                                                                                                    In container nurseries, R. solanacearum infects the cotyledons of emerging seedlings causing greyish-brown, water-soaked lesions, which spread to the entire cotyledon and become necrotic. The infection spreads to the adjoining stem and root tissues and the affected seedlings rot and die. Collar rot appears in 1- to 4-month-old bare-root seedlings as greyish-brown, water-soaked lesions at the collar region of seedlings, just above the soil level. The lesions spread longitudinally on the stem, both above and below ground level, becoming sunken and necrotic. The younger leaves become flaccid and droop followed by leaf scorching and pronounced vascular wilt. In bare-root nurseries, wilt usually occurs in small patches affecting individuals or groups of seedlings, which expand as more seedlings succumb to the infection.

                                                                                                                                                                                    Infection of mature foliage begins as greyish-brown to greyish-black, irregular lesions that spread to the entire leaf lamina. Infection spreads to the petioles and stems.

                                                                                                                                                                                    List of Symptoms/Signs

                                                                                                                                                                                    Top of page
                                                                                                                                                                                    SignLife StagesType
                                                                                                                                                                                    Fruit / lesions: black or brown
                                                                                                                                                                                    Growing point / distortion
                                                                                                                                                                                    Growing point / wilt
                                                                                                                                                                                    Leaves / abnormal colours
                                                                                                                                                                                    Leaves / abnormal leaf fall
                                                                                                                                                                                    Leaves / abnormal patterns
                                                                                                                                                                                    Leaves / necrotic areas
                                                                                                                                                                                    Leaves / odour
                                                                                                                                                                                    Leaves / wilting
                                                                                                                                                                                    Leaves / yellowed or dead
                                                                                                                                                                                    Roots / cortex with lesions
                                                                                                                                                                                    Roots / rot of wood
                                                                                                                                                                                    Roots / soft rot of cortex
                                                                                                                                                                                    Stems / discoloration
                                                                                                                                                                                    Stems / discoloration of bark
                                                                                                                                                                                    Stems / internal discoloration
                                                                                                                                                                                    Stems / necrosis
                                                                                                                                                                                    Stems / ooze
                                                                                                                                                                                    Stems / rot
                                                                                                                                                                                    Stems / wilt
                                                                                                                                                                                    Vegetative organs / internal rotting or discoloration
                                                                                                                                                                                    Whole plant / damping off
                                                                                                                                                                                    Whole plant / discoloration
                                                                                                                                                                                    Whole plant / dwarfing
                                                                                                                                                                                    Whole plant / plant dead; dieback
                                                                                                                                                                                    Whole plant / seedling blight

                                                                                                                                                                                    Biology and Ecology

                                                                                                                                                                                    Top of page

                                                                                                                                                                                    Variation

                                                                                                                                                                                    Ralstonia solanacearum species complex is represented by a heterogeneous population that has been reported variously as comprising groups, races, biovars, biotypes, sub-races and strains which have recently been re-classified within three individual species (Safni et al., 2014). The different classifications of R. solanacearum have caused considerable uncertainty. The commonly applied terms biovar and biotype refer to differences in biochemical and phage reactions (Hayward, 1962). Races (Buddenhagen et al., 1962) are distinguished on the basis of differences in plant host range.

                                                                                                                                                                                    Race 1 affects tobacco, tomato, potato, aubergine, diploid banana and many other (solanaceous) crops and weeds, and has a high temperature optimum (35-37°C). Race 2 affects triploid bananas (causing Moko disease) and Heliconia spp. and has a high temperature optimum (35-37°C). Race 3 mainly affects potatoes and tomatoes with lesser virulence to other solanaceous crops, and having a lower temperature optimum (27°C). Pelargonium can also be affected (Strider et al., 1981). Other hosts are the weeds Solanum dulcamara, S. nigrum, S. cinereum (in Australia), Urtica dioica (Urticaceae), Portulaca oleracea (Portulacaceae) and the composite weed Melampodium perfoliatum (in Costa Rica). Two additional races separately affecting ginger (Zingiber officinale) and mulberry (Morus spp.) have also been characterized (Buddenhagen, 1986).

                                                                                                                                                                                    On the other hand, Hayward (1964) distinguished four biotypes (biovars) by their ability to produce acid from six disaccharides and sugar alcohols and a phage reaction. Mulberry strains have been described as biovar 5 (Buddenhagen, 1986). These biovars do not generally correlate with the races of Buddenhagen et al. (1962) except that race 3 is equivalent to biovar 2 (Hayward, 1983). Races and biovars have been grouped into two major divisions according to their RFLP profiles (Cook and Sequeira, 1988, 1994). Asian strains of race 1 (biovars 3, 4, 5) clustered as a group (Division 'Asiaticum') while American strains of race 1 (biovar 1), race 2 (biovar 1) and race 3 (biovar 2) clustered as another group (Division 'Americanum'). This separation was later confirmed using other molecular markers. Division specific primers have been developed (Seal et al., 1999). A comparative study of PCR-RFLP profiles of the hrp gene region showed that strains from Reunion, Madagascar, Zimbabwe and Angola formed a separate cluster most similar to the Division 'Asiaticum' (Poussier et al., 1999).

                                                                                                                                                                                    The IIB/1=R3B2 strains of R. solanacearum which are known as potato brown rot ecotype cause wilting on potato, tomato, aubergine, pepper and geranium, and are adapted to the geographic regions characterized with a cool climate, which are often at high altitude (Wicker et al., 2012; Parkinson et al., 2013). Nevertheless, Bocsanczy et al. (2012) have identified race 1 biovar 1 Phylotype IIB Sequevar 4 strains in Florida which were able to infect and produce wilt symptoms on potato and tomato at 18°C. Bocsanczy et al. (2017) have identified candidate genes associated with the virulence under cool conditions. Race 3 (biovar 2) appeared to be homogeneous in early molecular fingerprinting studies. However, when South American strains of race 3 (biovar 2) became available more variation was observed than had previously been reported.

                                                                                                                                                                                    A: 'Normal' strains were found east of the watershed of the Andes and all over the world

                                                                                                                                                                                    B: Strains that were biochemically different, found only west of the Andean divide

                                                                                                                                                                                    C: Strains that were intermediate between race 1 and 3 were found from the lowlands of South America (also named biovar 2N or 2T)

                                                                                                                                                                                    Strain types B and C have not yet been reported elsewhere except for the 2T strains which were isolated in Iran (Janse, 1991; Gillings and Fahy, 1994; Hayward, 1994b; Smith et al., 1995; Sedighian et al., 2020). These findings, and the fact that resistance is found in wild Solanum phureja (Sequeira and Rowe, 1969), indicate that race 3 may have originated in South America. High genetic variability of R. solanacearum in Brazil described by Santiago et al. (2020) supports the hypothesis that the brown rot ecotype is autochthonous in Brazil and Peru.

                                                                                                                                                                                    Survival

                                                                                                                                                                                    Most plant pathogenic bacteria are usually closely associated with their living host plants and temporarily in infected host-plant debris. They survive for relatively brief periods in soil or other environments where competition is with active saprophytic populations. R. solanacearum is one of the few plant pathogenic bacteria for which there is evidence of survival in soil. Many weeds have been shown to be alternative hosts that maintain an on-going source of inoculum for the pathogen between crops. Race 3 survived for 2-3 years in Australia under bare fallow or pasture. Host debris, latent infected tubers and deeper soil layers were most important for survival (Graham and Lloyd, 1979; Graham et al., 1979). Pasqua di Bisceglie et al. (2005) investigated the survival of R. solanacearum in cold storage at 4°C on different materials which are used to make potato containers in stores. Survival on oak and poplar wood was 4 and 17 days, respectively. On high density polyethylene the bacterium survived until 48 h, while on jute fabric, the number of surviving bacteria was zero after 78 days. Mori et al. (2012) showed that the bacterium undergoes phenotypic conversion when present in the water extract of Solanum toxicarium for 4-5 days at a high concentration (108 CFU/ml).

                                                                                                                                                                                    Disease Development

                                                                                                                                                                                    Entry into plants is through wounds or stomata. Within the plant, the bacteria move in the vascular bundles, a process that is accelerated at higher temperatures. Speed of movement is also dependent on the plant part colonized. For instance, bacteria move more quickly in the stem than in the roots in tobacco (Ono et al., 1984). This is followed by colonization of the xylem (Xiao et al., 1983) where the bacteria adhere by polar attraction to the vessel walls, or invade the lumen. They subsequently become localized at preferential sites of the mesophyll (Petrolini et al., 1986). Blocking of the vessels by bacteria is considered to be the major cause of wilting. A histopathological comparison between susceptible and resistant Capsicum annuum was made by Rahman et al. (1999).

                                                                                                                                                                                    The disease is most severe at temperatures of 24-35°C and is seldom found where the mean temperature in winter falls below 10°C. There are specific temperature optima for disease development of the different races (biovars) (Swanepoel, 1990). High soil moisture and periods of wet weather or rainy seasons are associated with high disease incidence. Soil moisture also affects reproduction and survival of the pathogen; soil moisture levels of -0.5 to -1.0 bar favours disease expression whereas levels of -5 to -15 bar are unfavourable (Nesmith and Jenkins, 1985). Weather conditions, such as low temperatures, that are unfavourable for disease expression can conceal extensive infection. In Kenya, certified healthy potato seed tubers produced at altitudes of 1520-2120 m expressed disease when planted at lower altitudes (Nyangeri et al., 1984). For further information, see also Kelman (1953), OEPP/EPPO (1961), Buddenhagen and Kelman (1964), Persley (1986b), Hayward (1994b) and EPPO (2018).

                                                                                                                                                                                    Climate

                                                                                                                                                                                    Top of page
                                                                                                                                                                                    ClimateStatusDescriptionRemark
                                                                                                                                                                                    A - Tropical/Megathermal climate Tolerated Average temp. of coolest month > 18°C, > 1500mm precipitation annually
                                                                                                                                                                                    Af - Tropical rainforest climate Tolerated > 60mm precipitation per month
                                                                                                                                                                                    As - Tropical savanna climate with dry summer Tolerated < 60mm precipitation driest month (in summer) and < (100 - [total annual precipitation{mm}/25])
                                                                                                                                                                                    Aw - Tropical wet and dry savanna climate Tolerated < 60mm precipitation driest month (in winter) and < (100 - [total annual precipitation{mm}/25])
                                                                                                                                                                                    B - Dry (arid and semi-arid) Tolerated < 860mm precipitation annually
                                                                                                                                                                                    BS - Steppe climate Tolerated > 430mm and < 860mm annual precipitation
                                                                                                                                                                                    C - Temperate/Mesothermal climate Tolerated Average temp. of coldest month > 0°C and < 18°C, mean warmest month > 10°C
                                                                                                                                                                                    Cf - Warm temperate climate, wet all year Tolerated Warm average temp. > 10°C, Cold average temp. > 0°C, wet all year
                                                                                                                                                                                    Cs - Warm temperate climate with dry summer Tolerated Warm average temp. > 10°C, Cold average temp. > 0°C, dry summers
                                                                                                                                                                                    Cw - Warm temperate climate with dry winter Tolerated Warm temperate climate with dry winter (Warm average temp. > 10°C, Cold average temp. > 0°C, dry winters)
                                                                                                                                                                                    Am - Tropical monsoon climate Tolerated Tropical monsoon climate ( < 60mm precipitation driest month but > (100 - [total annual precipitation(mm}/25]))

                                                                                                                                                                                    Latitude/Altitude Ranges

                                                                                                                                                                                    Top of page
                                                                                                                                                                                    Latitude North (°N)Latitude South (°S)Altitude Lower (m)Altitude Upper (m)
                                                                                                                                                                                    60 60

                                                                                                                                                                                    Air Temperature

                                                                                                                                                                                    Top of page
                                                                                                                                                                                    Parameter Lower limit Upper limit
                                                                                                                                                                                    Mean annual temperature (ºC) -10 40

                                                                                                                                                                                    Natural enemies

                                                                                                                                                                                    Top of page
                                                                                                                                                                                    Natural enemyTypeLife stagesSpecificityReferencesBiological control inBiological control on
                                                                                                                                                                                    Bacillus cereus Pathogen
                                                                                                                                                                                    Bacillus licheniformis Pathogen
                                                                                                                                                                                    Bacillus polymixa Pathogen
                                                                                                                                                                                    Bacillus subtilis Pathogen
                                                                                                                                                                                    Burkholderia glumae Antagonist
                                                                                                                                                                                    Chainia flava Pathogen
                                                                                                                                                                                    Pseudomonas fluorescens Antagonist

                                                                                                                                                                                    Means of Movement and Dispersal

                                                                                                                                                                                    Top of page

                                                                                                                                                                                    Spread between countries usually involves vegetative propagating material that carries latent infections or is contaminated with the pathogen. Natural infection of true seed has only been established for groundnut (see Seed Transmission). Race 1 has been reported in tomato, Capsicum and aubergine seed (Persley, 1986b; Kelman et al., 1994; Singh, 1995) although till now poorly substantiated. As presently understood, soil-borne bacteria and transmission through vegetative plant parts are considered to be more important for most host plants as means of transmission of the pathogen than is true seed.

                                                                                                                                                                                    Race 2, which causes Moko disease of banana, is transmitted by insects and has a potential for rapid spread. Race 1 and 3 may be spread in water when infected riparian weeds such as Solanum dulcamara, Urtica dioica and Portulaca oleracea grow with their roots and stem parts in water. The bacterium may subsequently be spread to other hosts when contaminated water is used for irrigation (Olsson, 1976; Elphinstone et al., 1998; Janse et al., 1998, 2004; Farag et al., 1999Wenneker et al., 1999Alvarez et al., 2008; Tomlinson et al., 2009; Ustun et al., 2009).

                                                                                                                                                                                    Seed Transmission

                                                                                                                                                                                    Seed infection and disease transmission by seed caused by R. solanacearum has only been established for groundnut in Indonesia (Machmud and Middleton, 1990; Machmud, 1993) and China (Zhang et al., 1993; Dongfang et al., 1994). The bacterium was detected in the funiculus, pod shell, seed coat and embryo. The water content of the seed is an important factor in seed transmission and dry storage of seed severely impaired survival of the bacterium. It was suggested that dry preservation could lead to disease-free groundnut seed (Zhang et al., 1993). No other seed treatments have been reported. Natural seed infection in tomato and aubergine has been suggested for race 1 of R. solanacearum (Shakya, 1993; Chatterjee et al., 1994; Singh, 1994). Artificial seed contamination of tomato and Capsicum has been observed (Devi and Menon, 1980; Moffett et al., 1981). Sites of survival on seed have not been identified. Studies in Russia claim that the pathogen is transmitted with soyabean seeds (Klykov, 1951; Muras, 1964).

                                                                                                                                                                                    Seedborne Aspects

                                                                                                                                                                                    Top of page

                                                                                                                                                                                    Incidence

                                                                                                                                                                                    R. solanacearum has been shown to be seedborne in groundnut (Machmud and Middleton, 1991; Machmud, 1993; Zhang et al., 1993; Dongfang et al., 1994). The bacterium was detected in the funiculus, pod shell, seed coat and in the embryo (Machmud and Middleton, 1991; Machmud, 1993). Survival of R. solanacearum in groundnut seeds is closely related to the seed water content. The pathogen could not be detected in seeds with a water content of less than 10% (Zhang et al., 1993). R. solanacearum was not isolated from seeds stored for 1 year (Zeng et al., 1994).

                                                                                                                                                                                    A 38-100% incidence of infection of R. solanacearum was detected in aubergine seed collected from various regions of West Bengal, India. The pathogen survived well on seeds kept at 22°C and a relative humidity of 30-40%, but populations declined rapidly at 35°C or 50% RH (Chatterjee et al., 1994). Natural seed infection by R. solanacearum has also been reported in tomato (Shakya, 1993; Singh, 1994). The incidence of the bacterium was high in freshly extracted, non-sterilized seeds and fruit pulp obtained from tomatoes on plants inoculated through the leaf axil. Incidence was considerably reduced on surface-sterilized or dried seeds and the bacterium was not found in the embryo (Devi and Menon, 1980). R. solanacearum was detected among bacteria isolated from 46 samples of clover seed (Nikitina, 1974). The pathogen is reported as being seedborne on soyabean (Muras, 1963; Nikitina and Korsakov, 1978). These reports indicate that transmission of the pathogen from a diseased crop to succeeding crops grown from seed harvested from that crop is likely.

                                                                                                                                                                                    Pathogen Transmission

                                                                                                                                                                                    True Seed

                                                                                                                                                                                    When seeds from wilted groundnut plants were sown, they produced wilted plants at a frequency of 5-8% (Machmud and Middleton, 1991; Hong et al., 1994). In a similar study, seeds from wilted plants of both tomato and aubergine yielded pathogenic isolates of R. solanacearum. Seed infection usually resulted in wilting of adult plants. Seed from healthy plants obtained from a bacterial wilt infested field showed no evidence of the pathogen. However, no relationship was found between percentage seed infection and ultimate plant mortality (Roopali Singh, 1994). Moffett et al. (1981) demonstrated transmission of R. solanacearum to plants grown from tomato seeds artificially inoculated with 20,000 bacteria/seed. Perez et al. (2008) also report unexplained contamination of tomato seed through artificial inoculation.

                                                                                                                                                                                    Other sources

                                                                                                                                                                                    R. solanacearum has been shown to survive on plant residues for 2-3 years (Muras, 1963, 1964) and this is undoubtedly an important inoculum source for this pathogen. Infected seed potatoes, rhizomes of ginger and turmeric and other vegetative propagation material are also vehicles for the spread of R. solanacearum. Surface water contaminated with R. solanacearum is another important factor (Elphinstone, 1996; Elphinstone et al., 1998; Janse et al., 1998; Farag et al., 1999; Wenneker et al., 1999). The bacterium can also survive on wood (several days), metal (several weeks), rubber (several months), chicken and cattle manure (2-4 weeks) and waste from the potato processing industry (1-2 months) (Wenneker et al., 1998).

                                                                                                                                                                                    Seed Treatment

                                                                                                                                                                                    Long-term dry storage of groundnut seed reduced survival of R. solanacearum. It has been suggested that dry preservation could lead to disease-free groundnut seed (Zhang et al., 1993). Ultrasonic radiation of soyabean seeds reduced cotyledon infection in plants grown from these seeds (Krasnova, 1963). Phytobacteriocin reduced disease incidence and increased yield (Muras, 1964). Granosan, thiram and mercuran gave effective control (Klykov, 1951, 1963).


                                                                                                                                                                                    Seed Health Tests

                                                                                                                                                                                    Dilution plating (Kelman, 1954; Singh, 1994). Twenty-five seeds are ground and suspended in 1 ml sterile distilled water. Then, 0.1 ml of the suspension is plated on a semi-selective medium (Kelman, 1954; Singh, 1994) or placed directly on this medium. The development of distinctive mucoid magenta-pigmented colonies indicates the presence of the pathogen.

                                                                                                                                                                                    Grow-out
                                                                                                                                                                                    Seeds are germinated and seedlings tested for the presence of the pathogen (Shakya, 1993).

                                                                                                                                                                                    ELISA test
                                                                                                                                                                                    Rajeshwari et al. (1998) developed an ELISA test using polyclonal sera against the virulence exopolysaccharide component for detection of R. solanacearum in seed.

                                                                                                                                                                                    Note: An effective selective medium has been developed that may be used successfully for isolations from seed (Engelbrecht, 1994), modified by Elphinstone et al. (1996).

                                                                                                                                                                                    Pathway Causes

                                                                                                                                                                                    Top of page
                                                                                                                                                                                    CauseNotesLong DistanceLocalReferences
                                                                                                                                                                                    Biological control Yes Yes Anderson and Gardner (1999); Paret et al. (2008)
                                                                                                                                                                                    Botanical gardens and zoos Yes Yes
                                                                                                                                                                                    Breeding and propagation Yes Yes
                                                                                                                                                                                    Crop productionFrequent accidental or deliberate for use as biocontrol agent for Hedychium gardnerianum in tropical Yes Yes
                                                                                                                                                                                    Cut flower trade Yes Yes
                                                                                                                                                                                    Flooding and other natural disasters Yes Yes
                                                                                                                                                                                    Food Yes Yes
                                                                                                                                                                                    Forage Yes
                                                                                                                                                                                    Forestry Yes Yes
                                                                                                                                                                                    Garden waste disposal Yes Yes
                                                                                                                                                                                    Horticulture Yes Yes
                                                                                                                                                                                    Industrial purposespotato processing industry when not using waste treatment or waste treatment with only aerobic steps Yes Yes Janse (2012); Janse et al. (1998)
                                                                                                                                                                                    Interconnected waterways Yes
                                                                                                                                                                                    Landscape improvementmud from cleaning waterways which is then spread on fields. Yes
                                                                                                                                                                                    People sharing resources Yes Yes
                                                                                                                                                                                    Research Yes Yes
                                                                                                                                                                                    Seed trade Yes Yes

                                                                                                                                                                                    Pathway Vectors

                                                                                                                                                                                    Top of page
                                                                                                                                                                                    VectorNotesLong DistanceLocalReferences
                                                                                                                                                                                    Clothing, footwear and possessionsTransfer of vegetative germplasm. Yes
                                                                                                                                                                                    Debris and waste associated with human activities Yes
                                                                                                                                                                                    Floating vegetation and debris Yes
                                                                                                                                                                                    Germplasm Yes Yes
                                                                                                                                                                                    Land vehicles Yes
                                                                                                                                                                                    Machinery and equipment Yes Fortnum and Gooden (2008)
                                                                                                                                                                                    MailTransfer of vegetative germplasm. Yes
                                                                                                                                                                                    Plants or parts of plants Yes Yes
                                                                                                                                                                                    Soil, sand and gravelWater. Yes Yes
                                                                                                                                                                                    Water Yes
                                                                                                                                                                                    Host and vector organisms Yes Yes

                                                                                                                                                                                    Plant Trade

                                                                                                                                                                                    Top of page
                                                                                                                                                                                    Plant parts liable to carry the pest in trade/transportPest stagesBorne internallyBorne externallyVisibility of pest or symptoms
                                                                                                                                                                                    Bulbs/Tubers/Corms/Rhizomes Yes Pest or symptoms usually visible to the naked eye
                                                                                                                                                                                    Flowers/Inflorescences/Cones/Calyx Yes Pest or symptoms usually visible to the naked eye
                                                                                                                                                                                    Fruits (inc. pods) Yes Pest or symptoms usually visible to the naked eye
                                                                                                                                                                                    Growing medium accompanying plants Yes Pest or symptoms usually invisible
                                                                                                                                                                                    Leaves
                                                                                                                                                                                    Roots Yes Pest or symptoms not visible to the naked eye but usually visible under light microscope
                                                                                                                                                                                    Seedlings/Micropropagated plants Yes Pest or symptoms not visible to the naked eye but usually visible under light microscope
                                                                                                                                                                                    Stems (above ground)/Shoots/Trunks/Branches Yes Pest or symptoms not visible to the naked eye but usually visible under light microscope
                                                                                                                                                                                    True seeds (inc. grain)
                                                                                                                                                                                    Plant parts not known to carry the pest in trade/transport
                                                                                                                                                                                    Bark
                                                                                                                                                                                    Wood

                                                                                                                                                                                    Impact Summary

                                                                                                                                                                                    Top of page
                                                                                                                                                                                    CategoryImpact
                                                                                                                                                                                    Economic/livelihood Negative
                                                                                                                                                                                    Environment (generally) Negative

                                                                                                                                                                                    Impact

                                                                                                                                                                                    Top of page

                                                                                                                                                                                    Introduction

                                                                                                                                                                                    R. solanacearum is the most serious pathogen of solanaceous plants in tropical regions and can cause serious losses in temperate regions. Accurate data on yield losses and further economic impacts are not available. A review of the older literature can be found in Kelman (1953). A method to determine yield loss/disease severity for brown rot in potato has been described (Elphinstone, 1989). New high-yeilding but susceptible cultivars in place of older tolerant varieties, may cause problems in areas where the disease is endemic (Weingartner and Shumaker, 1984).

                                                                                                                                                                                    Many factors influence disease incidence and yield loss. In a study in India on sesame wilt incidence was significantly correlated with mean temperature, rainfall and relative humidity during the crop growth period (Hazarika and Das, 1999). In a study on the effects of physical soil properties it was found that sandy loam soil with a high sand content and low silt or clay content, with low water-holding capacity, was unfavourable for the pathogen and wilt incidence. Elevated disease levels were expressed in clay soils with high water-holding capacities (Keshwal et al., 2000).

                                                                                                                                                                                    Root colonization by ectomycorrhizal fungi is important in reducing disease levels and increasing tree growth in Eucalyptus spp. In China, disease in nurseries was reduced by 40-72% and in fields by 20-39% when seedlings were inoculated with eight fungal isolates. Height and basal diameter growth of trees in field trials were enhanced by 11.7 to 59.7% (Gong et al., 1999).

                                                                                                                                                                                    Greatest economic losses have been reported on potato, tobacco and tomato in the south-eastern USA, Indonesia (Sunarjono, 1980), Nepal, Uganda (Busolo-Bulafu et al., 1993), Brazil (Melo et al., 1999), Colombia and South Africa. In the Philippines, there were average losses of 15% in tomato, 10% in aubergine and Capsicum, and 2-5% in tobacco (Zehr, 1969). In the Amazon basin in Peru, banana plantations have been seriously affected with rapid spread of the pathogen in previously unaffected plantations (French and Sequeira, 1968). In India, there are sometimes total losses in tomato crops. Bacterial wilt also appears to be very common in wild and cultivated turmeric (Curcuma spp.) in Thailand and Indonesia (Thammakijjawat et al., 1999). Bacterial wilt is also a problem in ginger (Zingiber officinale); it was present in 80% of 310 fields surveyed in Himachal Pradesh, India (Sharma and Rana, 1999), and severe losses were reported from Thailand (Titatarn, 1985). R. solanacearum has been intercepted regularly from rhizomes exported for cut flower production in Europe. The disease may cause serious indirect losses when quarantine measures entail restriction movement of, or destruction of plant products (Hyde et al., 1992; Tuin et al., 1996).

                                                                                                                                                                                    Potato

                                                                                                                                                                                    Multiplication by cutting seed potato seriously increases the risk of high losses. Cut seed potato increased disease incidence by 250% and reduced yield by 40% (Vijayakumar et al., 1985). Extensive losses of potato were reported in Greece (Zachos, 1957). In Israel, losses were heavier in the spring potato crop than the autumn crop, because of the higher growing temperatures in spring (Volcani and Palti, 1960). Tuber rotting averaged 10%, reaching 50%, in stored potatoes in Nepal (Shrestha, 1996). Complete crop losses in small holdings in Nepal resulted from poor cultural practices including using seed from affected crops for subsequent plantings (Gurung and Vaidya, 1997). In Venezuela, in the period 1992-1996, R. solanacearum was found in most localities between 1100 and 3000 m above sea level, but was not found in localities at altitudes greater than 3000 m. Bacterial wilt disease incidence increased from 22% in 1992 to 37% in 1996 with disease incidence varying between 5 and 75%. Biovar 2 was present in greatest frequency and in most of the affected areas for potato (Garcia et al., 1999).

                                                                                                                                                                                    Tomato

                                                                                                                                                                                    In tomato hybrids, field grown in Taiwan for the fresh market, bacterial wilt incidence was 15-26% on improved tolerant hybrids compared to 55% in other hybrids (Hartman et al., 1991). In India, an investigation of the effect of time of infection showed that disease incidence, measured by plant mortality and plant yield, diminished with age of the plant at the time of inoculation. Maximum losses were recorded during the summer season (Kishun, 1987).

                                                                                                                                                                                    Groundnuts and Other Crops

                                                                                                                                                                                    In Vietnam, infection in groundnut was most severe in dryland cropping systems, especially on sandy soils along riverbanks, and on uplands (Hong et al., 1994). Tolerant varieties are infected by the pathogen but are not affected and can produce high yields (Liao et al., 1998). Bacterial wilt in groundnut (Race 1, biovars 3 and 4) is widespread in China. Annual disease incidence ranges from 4 to 8% on resistant cultivars. Pathogenicity varies between regions, the disease generally being more serious in southern provinces where losses of up to 20% were common (Yeh, 1990; Tan et al., 1994). Disease severity mostly increases if R. solanacearum is found in association with root nematodes. In tobacco, nematode infestation leads to greater susceptibility to bacterial wilt (Chen, 1984). When bacterial wilt of teak was initially recorded during the 1980s in Kerala, India, it appeared to be of little consequence. However, the incidence of the disease has increased over the years, both in nurseries and plantations. R. solanacearum causes mortality of bare-root and root trainer seedlings raised in high rainfall areas. Young plantations raised in waterlogged sites in areas of high rainfall (>3000 mm per annum) are more seriously affected. In these areas, the incidence of disease varied from <1% to ca 20% (Sharma et al., 1985). Synergistic interactions between R. solanacearum and Meloidogyne javanica have been reported (Sitaramaiah and Sinha, 1984; Verma et al., 1997; Pathak et al., 1999).

                                                                                                                                                                                    Environmental Impact

                                                                                                                                                                                    Top of page

                                                                                                                                                                                    When R. solanacearum establishes itself in riparian weed hosts (especially bittersweet, Solanum dulcamara) along rivers, the bacterium may (and did) spread via water and those hosts into nature reserves, where it is usually impossible and/or forbidden to control these weeds. This poses no threats to the nature reserves, but it may pose a problem for growers when they use surface water for irrigation. This is why in the Netherlands a nationwide ban for irrigation of seed potatoes is in place (Janse, 1996, 2012; Wenneker et al., 1999; Elphinstone et al., 1998; Elphinstone and Harris, 2002).

                                                                                                                                                                                    Risk and Impact Factors

                                                                                                                                                                                    Top of page
                                                                                                                                                                                    Invasiveness
                                                                                                                                                                                    • Invasive in its native range
                                                                                                                                                                                    • Proved invasive outside its native range
                                                                                                                                                                                    • Has a broad native range
                                                                                                                                                                                    • Abundant in its native range
                                                                                                                                                                                    • Highly adaptable to different environments
                                                                                                                                                                                    • Is a habitat generalist
                                                                                                                                                                                    • Pioneering in disturbed areas
                                                                                                                                                                                    • Tolerant of shade
                                                                                                                                                                                    • Capable of securing and ingesting a wide range of food
                                                                                                                                                                                    • Highly mobile locally
                                                                                                                                                                                    • Fast growing
                                                                                                                                                                                    • Has high reproductive potential
                                                                                                                                                                                    • Has propagules that can remain viable for more than one year
                                                                                                                                                                                    • Has high genetic variability
                                                                                                                                                                                    Impact outcomes
                                                                                                                                                                                    • Host damage
                                                                                                                                                                                    • Negatively impacts agriculture
                                                                                                                                                                                    • Negatively impacts forestry
                                                                                                                                                                                    • Damages animal/plant products
                                                                                                                                                                                    • Negatively impacts trade/international relations
                                                                                                                                                                                    Impact mechanisms
                                                                                                                                                                                    • Pathogenic
                                                                                                                                                                                    • Rapid growth
                                                                                                                                                                                    Likelihood of entry/control
                                                                                                                                                                                    • Highly likely to be transported internationally accidentally
                                                                                                                                                                                    • Highly likely to be transported internationally deliberately
                                                                                                                                                                                    • Highly likely to be transported internationally illegally
                                                                                                                                                                                    • Difficult to identify/detect as a commodity contaminant
                                                                                                                                                                                    • Difficult to identify/detect in the field
                                                                                                                                                                                    • Difficult/costly to control

                                                                                                                                                                                    Uses List

                                                                                                                                                                                    Top of page

                                                                                                                                                                                    Environmental

                                                                                                                                                                                    • Biological control

                                                                                                                                                                                    General

                                                                                                                                                                                    • Laboratory use
                                                                                                                                                                                    • Research model

                                                                                                                                                                                    Diagnosis

                                                                                                                                                                                    Top of page

                                                                                                                                                                                    Isolation is best made from early infection stages, small pieces of tissue being excised from the margins preferably of the youngest lesions. These are comminuted in small quantities of sterile water and streaked on TTC medium (Schaad et al., 2001) or very good selective medium SMSA developed by Engelbrecht (1994) and modified by Elphinstone et al. (1996) and incubated at 25-27°C for 2 days. Isolation can also be readily made by streaking suspensions of bacterial ooze obtained from cut infected tissue. The development of largely unmixed mucoid magenta colonies on TTC medium or is a good indication that the pathogen has been isolated. Single colonies are sub-cultured onto nutrient agar for storage and confirmation of the identity of the pathogen using the tests described in Schaad et al. (2001).

                                                                                                                                                                                    Biochemical tests, fatty acid analysis, RFLP and protein analysis can be used for identification purposes (Seal et al., 1993; Seal and Elphinstone, 1994; Anon., 1997, 1998, 2006; Stefani and Mazzucchi, 1997; Hartung et al., 1998; Wullings et al., 1998; Seal et al., 1999; OEPP/EPPO, 2004).

                                                                                                                                                                                    Highly specific and sensitive molecular probes based on unique DNA sequences obtained by DNA subtraction methods can readily be developed for the pathogen to confirm the identity of the pathogen including strains obtained from symptomless plants. These methods are only used when a high level of confidence in identification is necessary to support eradication programmes or quarantine restrictions that may involve compensation. Nitrocellulose membrane (NCM)-ELISA kits were used by Bekele et al. (2011) to confirm the presence of bacterial wilt, caused by R. solanacearum, in potato leaves. The use of colony PCR-SSCP technique for the diagnosis of R. solanacearum is described in Umesha et al. (2012), and is advocated by Chandrashekara et al. (2012). A method for the identification of R. solanacearum race 2 is described in Gund et al. (2011). The use of matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) for rapid and accurate identification of R. solanacearum and R. pseudosolanacearum was reported by van de Bilt et al. (2018).

                                                                                                                                                                                    Furthermore, species-specific PCR techniques have developed for exact identification of suspected strains in race/biovar/ecotype level. For this aim, the strains with a typical R. solanacearum morphology on TTC medium (i.e., creamy-white colonies with a pink centre) are subjected to PCR tests using the RSSC-specific primer pair 759/760 (Opina et al., 1997). Furthermore, a multiplex PCR using a set of five phylotype-specific primers (i.e., Nmult21:1F, Nmult21:2F, Nmult22:InF, Nmult23:AF and Nmult22:RR) was developed to assign the bacterial strains into their corresponding phylotype (Fegan and Prior, 2005; Toukam et al., 2009). Primer sequences and size of the expected amplicon in each primer pair are described below. Strains that were classified in phylotype II could be further investigated using the primer pair 630-F/631-R (Fegan et al., 1998), to test their affiliation to ‘potato brown rot ecotype’ which is equivalent to phylotype IIB/sequevar 1 (IIB-1).

                                                                                                                                                                                    Primer name

                                                                                                                                                                                    5´- 3´ sequence

                                                                                                                                                                                    Size of amplicon (bp)

                                                                                                                                                                                    Annealing Temperature (°C)

                                                                                                                                                                                    Target

                                                                                                                                                                                    Reference

                                                                                                                                                                                    759

                                                                                                                                                                                    GTCGCCGTCAACTCACTTTCC

                                                                                                                                                                                    280

                                                                                                                                                                                    63

                                                                                                                                                                                    16S-23S Intergenic Spacer; RSSC-specific

                                                                                                                                                                                    Opina et al., 1997

                                                                                                                                                                                    760

                                                                                                                                                                                    GTCGCCGTCAGCAATGCGGAATCG

                                                                                                                                                                                    630-F

                                                                                                                                                                                    ATACAGAATTCGACCGGCACG

                                                                                                                                                                                    278

                                                                                                                                                                                    60

                                                                                                                                                                                    16s rDNA; phylotype II- specific

                                                                                                                                                                                    Fegan et al., 1998

                                                                                                                                                                                    631-R

                                                                                                                                                                                    AATCACATGCAATTCGCCTACG

                                                                                                                                                                                    Nmult21:1:F

                                                                                                                                                                                    CGTTGATGAGGCGCGCAATTT

                                                                                                                                                                                    144: Phylotype I

                                                                                                                                                                                    372: Phylotype II

                                                                                                                                                                                    91: Phylotype III

                                                                                                                                                                                    213: Phylotype IV

                                                                                                                                                                                    59

                                                                                                                                                                                    ITS

                                                                                                                                                                                    Fegan and Prior, 2005

                                                                                                                                                                                    Nmult21:2:F

                                                                                                                                                                                    AAGTTATGGACGGTGGAAGTC

                                                                                                                                                                                    Nmult22:InF

                                                                                                                                                                                    ATTGCCAAGACGAGAGAAGTA

                                                                                                                                                                                    Nmult23:AF

                                                                                                                                                                                    ATTACGAGAGCAATCGAAAGATT

                                                                                                                                                                                    Nmult22:RR

                                                                                                                                                                                    TCGCTTGACCCTATAACGAGTA

                                                                                                                                                                                    Different sets of high throughput DNA sequence-based molecular techniques have also been developed for phylogenetic analysis and typing of the bacterial wilt strains. For instance, multilocus sequence analysis (MLSA) and typing (MLST) using the sequences of eight chromosomal housekeeping genes (i.e. gapA, gdhA, ppsA, adK, gyrB, mutS, rplB and leuS) and three megaplasmid virulence-associated genes (i.e. egl, fliC and hrpB) is capable of confirming the phylotype/sequevar status of the RSSC strans (Castillo and Greenberg, 2007; Wicker et al., 2012). Furthermore, a multilocus variable-number tandem-repeat analysis (MLVA) scheme was developed for monitoring microevolutions within different poulations of R. solanacearum (Parkinson et al., 2013; N'Guessan et al., 2013; Ravelomanantsoa et al., 2016; Guinard et al. 2017).

                                                                                                                                                                                    Detection and Inspection

                                                                                                                                                                                    Top of page

                                                                                                                                                                                    The bacterium may be obtained from infected tubers or stems for staining purposes if a small portion of tissue is pressed onto a clean glass slide. Potato tubers can be visually checked for internal symptoms by cutting. Suspect tubers should be diagnosed in the laboratory. Appropriate laboratory methods to detect the pathogen have been laid down in a harmonized EU-interim scheme for detection of the brown rot bacterium (Anon., 1997). These methods are based on earlier described indirect immunofluorescence antibody staining (IFAS). Standard samples of 200 tubers per 25 t of potatoes are taken (Janse, 1988; OEPP/EPPO, 1990a; Anon., 1997, 1998, 2006; Stefani et al. 2005). Garcıa et al. (2019) have prepared a guide for rapid field diagnosis of bacterial wilt disease on different annual crops.

                                                                                                                                                                                    The use of FTA (Whatman) cards reduces the time and labour needed for obtaining nucleic acid from suspicious plant materials (Chandrashekara et al. 2012; Burlakoti et al., 2020). Tran et al. (2016) showed that PCR from FTA cards was faster, easier and sensitive enough to detect approximately 104 CFU/ml in naturally infected plant tissues. Recently a very effective selective medium has been described (Engelbrecht, 1994, and modified by Elphinstone et al., 1996) that can also be applied for detection in environmental samples such as surface water, soil and waste (Janse et al., 1998; Wenneker et al., 1999). ELISA and PCR, based on 16S rRNA targeted primers as well as fluorescent in-situ hybridization (FISH) using 16S and 23S rRNA-targeted probes, have also been used. Specific loop-mediated isothermal amplification LAMP-based detection methods have also been developed for each of the lineages of R. solanacearum (Lenarčič et al., 2014). In terms of sensitivity, it has been shown that LAMP and quantitative PCR were most sensitive detected methods for R. solanacearum, followed by conventional PCR and ELISA (Okiro et al., 2019). Singh et al. (2014) developed a Bio-PCR method based on the hrp gene sequence for detection of R. solanacearum in asymptomatic tomato plants, irrigation water, and soil through non-selective enrichment of casamino acids-pepton-glucose broth medium.

                                                                                                                                                                                    Ralstonia syzygii, causal agent of Sumatra disease of clove (Syzygium) and the distinct Blood Disease Bacterium, causal agent of blood disease of banana in Indonesia, are closely related to R. solanacearum and cross-react in serological and DNA-based detection methods (Wullings et al., 1998Thwaite et al., 1999).

                                                                                                                                                                                    Similarities to Other Species/Conditions

                                                                                                                                                                                    Top of page

                                                                                                                                                                                    Brown rot symptoms caused by R. solanacearum in potato may be confused with those caused by Clavibacter sepedonicus, agent for ring rot of potato. Brown rot usually develops earlier in the season and is more rapid than ring rot. For ring rot, leaves show intercostal yellowing, which is absent with brown rot, and bacterial slime does not exude spontaneously from the tuber. Only when the tuber is pressed does a mass of whitish-to-yellow macerated vascular tissue and bacterial slime emerge. Soil does not stick to the heel end or eyes of ring rot-infected tubers. Symptoms of bacterial wilt in tomato may be confused with those caused by Clavibacter michiganensis, agent of bacterial canker. This disease is expressed as white, necrotic spots on the leaves that are absent in bacterial wilt. Adventitious root formation seen in wilt is absent in bacterial canker, whereas the vascular discoloration in canker is more yellow in colour than in bacterial wilt.

                                                                                                                                                                                    For Moko disease on banana, symptoms may be confused with those of Fusarium oxysporum f.sp. cubense. A brown and dry rot of the fruits is present only in the case of Moko disease. Moko disease can also be confused with banana blood disease, caused by the so-called blood disease bacterium (Ralstonia sp. nr solanacearum), occurring in Indonesia (Eden-Green, 1994).

                                                                                                                                                                                    Prevention and Control

                                                                                                                                                                                    Top of page

                                                                                                                                                                                    Due to the variable regulations around (de)registration of pesticides, your national list of registered pesticides or relevant authority should be consulted to determine which products are legally allowed for use in your country when considering chemical control. Pesticides should always be used in a lawful manner, consistent with the product's label.

                                                                                                                                                                                    Control of bacterial wilt is very difficult, largely being dependent on good crop management practices. Yuliar et al. (2015) reviewed recent developments in the management of bacterial wilt disease. The use of certified disease-free seeds/tubers/transplants, reliable and early detection of the pathogen, quarantine measures on infected fields and farms, sufficient crop rotation, control of weed hosts, volunteer plants and nematodes where present, avoidance of surface water for irrigation, and education are key factors in control (Janse, 1996; Pradhanang and Elphinstone, 1996b).

                                                                                                                                                                                    Seed potato tubers and seeds of other solanaceous plants should be obtained from crops that have been inspected and found disease-free for the last two growing seasons. Visual inspections should be performed routinely upon export and import. Laboratory checks for low level infection and contamination may be necessary. Plants of Musa spp. should be kept in post-entry quarantine (OEPP/EPPO, 1990b).

                                                                                                                                                                                    Cutting seed potato tubers should be avoided. Crop rotation of 5-7 years without susceptible crops has been recommended. The disease may also be controlled by the application of fertilizers to change soil pH. In the USA, lowering the soil pH to 4-5 in summer and raising it to pH 6 in the autumn eradicated the pathogen (Graham and Lloyd, 1979; Graham et al., 1979).

                                                                                                                                                                                    Tolerant cultivars of potato, aubergine (Dalal et al., 1999; Quezado-Soares et al., 1997), tobacco, groundnut and other crops are available, but the race and strain diversity of the pathogen means that cultivars must be selected with care. Potato cultivars were selected in Colombia with tolerance derived from Solanum phureja and S. demissum (French, 1985; Hartman and Elphistone, 1994). Tobacco-resistant cultivars have been developed (Lopez et al., 1978). In China, wilt-resistant groundnut cultivars appear to be the most important control measure (Tan et al., 1994) although they have a lower yield potential due to reduced nodulation and nitrogen fixation by Rhizobium bacteria (Liao et al., 1992). Because tolerant plants may be infected and contaminated with the pathogen without symptom expression (Grimault and Prior, 1993) movement of these cultivars into disease-free regions may introduce the pathogen.

                                                                                                                                                                                    Grafting of aubergine on resistant Solanum species has been shown to be successful (Mochizuki and Yamakawa, 1979). Grafting of tomato on resistant aubergine rootstock reduced losses by 90% (Lum and Wong, 1976). A new technique of raising brinjal seedlings on coir piths has shown some promise in controlling the disease. Once transplanted, the plants are immune to diseases for about 30-40 days, after which they are not greatly affected by bacterial wilt (ProMED-Plant, 2010). Resistance in tomato and other hosts may be reduced by nematode infection (Yen et al., 1997; Deberdt et al., 1999). Furusawa et al., (2019) demonstrated that simultaneous infection of R. solanacearum and root‐knot nematode Meloidogyne incognita increases the severity of bacterial wilt in tomato, where the galls induced by the nematode are a suitable location for bacterial growth.

                                                                                                                                                                                    Intercropping of potato with maize or Phaseolus vulgaris reduced inoculum density and disease development in some cases (Autrique and Potts, 1987) but the pathogen was found to persist in these alternative hosts (Granada and Sequeira, 1983). In a crop rotation trial it was found that resting land for 3 years reduced wilt from 80.1 to less than 7.5%. Tuber rot was reduced and crop yield enhanced. For potato, a minimum fallow period of 2 years appeared to be adequate to obtain good yields (Mateo et al., 1982).

                                                                                                                                                                                    Wilt severity in tomato was reduced by a rotation system using maize, okra, cowpea or resistant tomato. The onset of bacterial wilt was delayed by 1-3 weeks and wilt severity was reduced by 20-26% (Adhikari and Basnyat, 1998). Tomato in rotation with rice was also effective in reducing R. solanacearum populations in Taiwan (Michel et al., 1996). Rotation of groundnut with rice and with maize, wheat, sorghum and sugarcane was effective in reducing incidence and severity (Hong et al., 1994; Tan et al., 1994). In tobacco, disease incidence was reduced and the yield was increased by cultivar resistance and by 1-year rotation with maize, fescue (Festuca sp.) or soyabean (Melton and Powell, 1991).

                                                                                                                                                                                    Hot-air treatment of ginger roots for 30 min at 50°C has been successful (Tsang and Shintaku, 1998). Treatment of soils using stable bleaching powder gave disease suppression of 70-89% in greenhouse and field trials (Dhital et al., 1997) and in combination with deep ploughing (Kishore et al., 1996). Data collected over 3 years revealed that pre-treatment of soil with bleaching powder controlled the disease by 68.4% (Verma and Shekhawat, 1991). Effects of soil amendments are soil dependent (Michel and Mew, 1998). Soil fumigants showed either slight or no effects (Murakoshi and Takahashi, 1984). Some compounds based on hydrogen peroxide and peracetic acids (and catalase-inhibitors) show promising results for disinfection of contaminated surface water (Janse et al., 1998; Niepold, 1999).

                                                                                                                                                                                    Along with the integrated disease management strategies (Biswal and Dhal, 2018), several attempts have been made to develop a biological control method against the bacterial wilt pathogen (Rocha and Moura, 2013; Kheirandish and Harighi, 2015; Chen et al., 2019). Biological control of the pathogen has been reported using bacterial strains isolated from soil (Nguyen and Ranamukhaarachchi, 2010). Application of clove oil, chitosan and Paenibacillus strains significantly reduced the incidence and severity of the bacterial wilt disease (Huang and Lakshman, 2010). The application of chitosan as a seed treatment reduced wilt incidence by 48%, and the application of the Paenibacillus polymyxa strain MB02-1007 reduced wilt incidence by 88% (Algam et al., 2010). Furthermore, amending tomato field topsoil with cocopeat, farmyard manure compost and green compost suppressed bacterial wilt severity and pathogen survival in the soil, and increased tomato yield in Ethiopia (Yadessa et al., 2010). Positive results were achieved in laboratory experiments with the antagonistic bacteria Bacillus polymyxa and Pseudomonas fluorescens (Aspiras and Cruz, 1985). Success has been claimed for P. fluorescens in potato in laboratory and field trials. Avirulent mutants of the bacterium have also been used in some studies (Ciampi-Panno et al., 1989; Gallardo and Panno, 1989; Hartman and Elphinstone, 1994). It has been reported that Ralstonia pickettii strain QL-A6 is an effective biocontrol agent for bacterial wilt of tomato (Wei et al., 2013). Several studies have also been conducted to evaluate the use of bacteriophages which are capable of infecting R. solanacearum (Lee and Park, 2016; Elhalag et al., 2018). Effectiveness of essential oils from different plant species and incorporation of plant materials into soil has also been investigated to combat the bacterial wilt pathogen (Pontes et al., 2011; Alves et al., 2014; Tu et al., 2020). However, none of the above-mentioned biological methods has successfully been used on a commercial scale.

                                                                                                                                                                                    Chemical control is ineffective. Antibiotics, streptomycin, ampicillin, tetracycline and penicillin showed hardly any effect (Farag et al., 1982); in fact, streptomycin application increased the incidence of bacterial wilt in Egypt (Farag et al., 1986). The field use of calcium carbonate (CaCO3) reduced disease incidence and it has been suggested that CaCO3 could be used as a potential soil amendment for management of bacterial wilt disease (He et al., 2014).

                                                                                                                                                                                    References

                                                                                                                                                                                    Top of page

                                                                                                                                                                                    ===, 1978. Data sheets on quarantine organisms. Set 1. Bulletin, Organisation Europeenne et Mediterraneenne pour la Protection des Plantes, 8(2)

                                                                                                                                                                                    1990. Quarantine procedure No. 26. Pseudomonas solanacearum. Inspection and test methods. Bulletin OEPP, 20(2):255-262

                                                                                                                                                                                    Adhikari TB, Basnyat RC, 1998. Effect of crop rotation and cultivar resistance on bacterial wilt of tomato in Nepal. Can. J. Plant Pathol. 20:283-287

                                                                                                                                                                                    Alfenas AC, Mafia RG, Sartório RC, Binoti DHB, Silva RR, Lau D, Vanetti CA, 2006. Ralstonia solanacearum on eucalyptus clonal nurseries in Brazil. (Ralstonia solanacearum em viveiros clonais de eucalipto no Brasil.) Fitopatologia Brasileira, 31(4):357-366. http://www.scielo.br/pdf/fb/v31n4/05.pdf

                                                                                                                                                                                    Algam SAE, Xie G, Li B, Yu S, Su T, Larsen J, 2010. Effects of Paenibacillus strains and chitosan on plant growth promotion and control of Ralstonia wilt in tomato. Journal of Plant Pathology, 92(3):593-600. http://www.sipav.org/main/jpp/volumes/0310/031002.pdf

                                                                                                                                                                                    Âlvarez B, López MM, Biosca EG, 2008. Survival strategies and pathogenicity of Ralstonia solanacearum phylotype II subjected to prolonged starvation in environmental water microcosms. Microbiology (Reading), 154(11):3590-3598. http://mic.sgmjournals.org

                                                                                                                                                                                    Alves, A. O., Santos, M. M. B., Santos, T. C. G., Souza, E. B., Mariano, R. L. R., 2014. Biofumigation with essential oils for managing bacterial wilt of sweet peppers. Journal of Plant Pathology, 96(2), 363-367. http://www.sipav.org/main/jpp/

                                                                                                                                                                                    Anderson RC, Gardner DE, 1999. An evaluation of the wilt-causing bacterium Ralstonia solanacearum as a potential biological control agent for the alien kahili ginger (Hedychium gardnerianum) in Hawaiian forests. Biological Control, 15(2):89-96; 27 ref

                                                                                                                                                                                    Andrade FWRde, Amorim EPda R, Eloy AP, Rufino MJ, 2009. Occurence of banana diseases in the state of Alagoas. (Ocorrência de doenças em bananeiras no estado de Alagoas.) Summa Phytopathologica, 35(4):305-309. http://www.scielo.br/pdf/sp/v35n4/a08v35n4.pdf

                                                                                                                                                                                    Anon., 1997. Interim testing scheme for the diagnosis, detection and identification of Pseudomonas solanacearum (Smith) Smith in potatoes. Publication 97/647/EC, Official Journal European Communities, 273, 1-25.

                                                                                                                                                                                    Anonymous, 1998. Council Directive 98/57/EC of 20 July 1998 on the control of Ralstonia solanacearum. Annex II-test scheme for the diagnosis, detection and identification of Ralstonia solanacearum. Official Journal of the European Communities, L235:8-39

                                                                                                                                                                                    Anonymous, 2006. Commission Directive 2006/63/EC of 14 July 2006: amending Annexes II to VII to Council Directive 98/57/EC on the control of Ralstonia solanacearum (Smith) Yabuuchi et al. Official Journal of the European Communities, L206:36-106

                                                                                                                                                                                    Aspiras RB, Cruz ARde la, 1985. Potential biological control of bacterial wilt in tomato and potato with Bacillus polymyxa FU6 and Pseudomonas fluorescens.. Bacterial wilt disease in Asia and the South Pacific., 89-92; [ACIAR Proceedings No. 13]; 13 ref

                                                                                                                                                                                    Autrique A, Potts MJ, 1987. The influence of mixed cropping on the control of potato bacterial wilt (Pseudomonas solanacearum). Annals of Applied Biology, 111:125-133

                                                                                                                                                                                    Banani Chatterjee, Chakraborty M, Habib AKMA, Samaddar KR, 1994. Survival of Pseudomonas solanacearum biovar 3 on seeds of eggplant. Bacterial Wilt Newsletter, No. 11:11

                                                                                                                                                                                    Bekele B, Abate E, Asefa A, Dickinson M, 2011. Incidence of potato viruses and bacterial wilt disease in the west Amhara sub-region of Ethiopia. Journal of Plant Pathology, 93(1):149-157. http://sipav.org/main/jpp/index.php/jpp/article/view/285/151

                                                                                                                                                                                    BELALCÂZAR C, S, URIBE M, G, THURSTON HD, 1968. The recognition of hosts of Pseudomonas solanacearum in Colombia. (Reconocimiento de hospedantes a Pseudomonas solanacearum (E.F. Sm.), en Colombia.) Revista Inst. Colomb. agropec, 3:37-46

                                                                                                                                                                                    Bilt, J. L. J. van de, Wolsink, M. H. L., Gorkink-Smits, P. P. M. A., Landman, N. M., Bergsma-Vlami, M., 2018. Application of matrix-assisted laser desorption ionization time-of-flight mass spectrometry for rapid and accurate identification of Ralstonia solanacearum and Ralstonia pseudosolanacearum. European Journal of Plant Pathology, 152(4), 921-931. doi: 10.1007/s10658-018-1517-5

                                                                                                                                                                                    Biswal, G., Dhal, N. K., 2018. Management of bacterial wilt disease of potato in coastal plains of Odisha. African Journal of Microbiology Research, 12(12), 284-289. doi: 10.5897/AJMR2017.8714

                                                                                                                                                                                    Bocsanczy, A. M., Achenbach, U. C. M., Mangravita-Novo, A., Yuen, J. M. F., Norman, D. J., 2012. Comparative effect of low temperature on virulence and twitching motility of Ralstonia solanacearum strains present in Florida. Phytopathology, 102(2), 185-194. doi: 10.1094/PHYTO-05-11-0145

                                                                                                                                                                                    Bocsanczy, A. M., Huguet-Tapia, J. C., Norman, D. J., 2017. Comparative genomics of Ralstonia solanacearum identifies candidate genes associated with cool virulence. Frontiers in Plant Science, 8(September), 1565. doi: 10.3389/fpls.2017.01565

                                                                                                                                                                                    Bradbury JF, 1986. Guide to Plant Pathogenic Bacteria. Wallingford, UK: CAB International

                                                                                                                                                                                    Buddenhagen IW, 1986. Bacterial wilt revisited. In: Bacterial Wilt Disease in Asia and the South Pacific. Proceedings of an International Workshop held at PCARRD, Los Banos, Philippines 8-10 October 1985 ACIAR Proceedings, 126-143

                                                                                                                                                                                    Buddenhagen IW, Kelman A, 1964. Biological and physiological aspects of bacterial wilt caused by Pseudomonas solanacearum. Annual Review of Phytopathology, 2:203-230

                                                                                                                                                                                    Buddenhagen IW, Sequeira L, Kelman A, 1962. Designation of races of Pseudomonas solanacearum. Phytopathology, 52:726

                                                                                                                                                                                    Burlakoti, R. R., Hsu ChiouFen, Chen JawRong, Sheu ZongMing, Bihon, W., Kenyon, L., 2020. Capture of Ralstonia solanacearum species complex strains directly from plant tissue sampled on FTA cards for molecular characterization. Journal of Plant Pathology, 102(1), 11-17. doi: 10.1007/s42161-019-00361-z

                                                                                                                                                                                    Busolo-Bulafu CM, Mehan VK, Hayward-AC, 1993. Present status of groundnut bacterial wilt research in Uganda. Groundnut bacterial wilt. Mehan VK (ed.) Proceedings of the Second Working Group Meeting, 2 Nov. 1992. Tainan, Taiwan: Asian Vegetable Res. & Developm. Center, pp. 11-14

                                                                                                                                                                                    Caruso P, Palomo JL, Bertolini E, Âlvarez B, López MM, Biosca EG, 2005. Seasonal variation of Ralstonia solanacearum biovar 2 populations in a Spanish river: recovery of stressed cells at low temperatures. Applied and Environmental Microbiology, 71(1):140-148

                                                                                                                                                                                    Castillo JA, Greenberg JT, 2007. Evolutionary dynamics of Ralstonia solanacearum. Applied and Environmental Microbiology, 73(4):1225-1238. http://aem.asm.org

                                                                                                                                                                                    Cellier G, Prior P, 2010. Deciphering phenotypic diversity of Ralstonia solanacearum strains pathogenic to potato. Phytopathology, 100(11):1250-1261. http://www.apsnet.org/phyto/

                                                                                                                                                                                    Chandrashekara KN, Prasannakumar MK, 2010. New host plants for Ralstonia solanacearum from India. New Disease Reports, 22:Article 6. http://www.ndrs.org.uk/article.php?id=22006

                                                                                                                                                                                    Chandrashekara, K. N., Prasannakumar, M. K., Manthirachalam Deepa, Akella Vani, Khan, A. N. A., 2012. Prevalence of races and biotypes of Ralstonia solanacearum in India. Journal of Plant Protection Research, 52(1), 53-58. doi: 10.2478/v10045-012-0009-4

                                                                                                                                                                                    Chen WY, 1984. Influence of the root-knot nematode on wilt resistance of flue-cured tobacco infested by Pseudomonas solanacearum. Bulletin of the Tobacco Research Institute, 21:44-48

                                                                                                                                                                                    Chen, M. C., Wang, J. P., Zhu, Y. J., Liu, B., Yang, W. J., Ruan, C. Q., 2019. Antibacterial activity against Ralstonia solanacearum of the lipopeptides secreted from the Bacillus amyloliquefaciens strain FJAT-2349. Journal of Applied Microbiology, 126(5), 1519-1529. doi: 10.1111/jam.14213

                                                                                                                                                                                    Ciampi-Panno L, Fernandez C, Bustamante P, Andrade N, Ojeda S, Contreras A, 1989. Biological control of bacterial wilt of potatoes caused by Pseudomonas solanacearum. American Potato Journal, 66:315-332

                                                                                                                                                                                    Cook D, Sequeira L, 1994. Strain differentiation of Pseudomonas solanacearum by molecular genetic methods. In: Hayward AC, Hartman GL, eds. Bacterial wilt: the Disease and its Causative Agent, Pseudomonas solanacearum. Wallingford, UK: CAB International, 77-93

                                                                                                                                                                                    Cook DR, Sequeira L, 1988. The use of restriction fragment length polymorphism (RFLP) analysis in taxonomy and diagnosis. Bacterial Wilt Newsletter, 4:4

                                                                                                                                                                                    Cruz L, Eloy M, Quirino F, Carrinho H, 2008. Ralstonia solanacearum biovar 1 associated with a new outbreak of potato brown rot in Portugal. Phytopathologia Mediterranea, 47(2):87-91. http://epress.unifi.it/riviste

                                                                                                                                                                                    Cruz L, Eloy M, Quirino F, Oliveira H, Tenreiro R, 2012. Molecular epidemiology of Ralstonia solanacearum strains from plants and environmental sources in Portugal. European Journal of Plant Pathology, 133(3):687-706. http://springerlink.metapress.com/link.asp?id=100265

                                                                                                                                                                                    Dalal NR, Dalal SR, Golliwar VG, Khobragade RI, 1999. Studies on grading and pre-packaging of some bacterial wilt resistant brinjal (Solanum melongena L.) varieties. Journal of Soils and Crops, 9(2):223-226; 4 ref

                                                                                                                                                                                    Date H, Inoue K, Nasu H, Hatamoto M, 1994. Bacterial wilt of Eustoma russellianum caused by Pseudomonas solanacearum. Annals of the Phytopathological Society of Japan, 60:366

                                                                                                                                                                                    Deberdt P, QuTnThervT P, Darrasse A, Prior P, 1999. Increased susceptibility to bacterial wilt in tomatoes by nematode galling and the role of the Mi gene in resistance to nematodes and bacterial wilt. Plant Pathology, 48(3):408-414; 29 ref

                                                                                                                                                                                    Deberdt, P., Guyot, J., Coranson-Beaudu, R., Launay, J., Noreskal, M., Rivière, P., Vigné, F., Laplace, D., Lebreton, L., Wicker, E., 2014. Diversity of Ralstonia solanacearum in French Guiana expands knowledge of the "emerging ecotype". Phytopathology, 104(6), 586-596. doi: 10.1094/PHYTO-09-13-0264-R

                                                                                                                                                                                    Devi LR, Menon MR, 1979, publ. 1980. Additional hosts of Pseudomonas solanacearum. Indian Phytopathology, 32(3):452-453

                                                                                                                                                                                    Devi LR, Menon MR, 1980. Transmission of Pseudomonas solanacearum through tomato seeds. Agricultural Research Journal of Kerala, 18:120-122

                                                                                                                                                                                    Dhital SP, Thaveechai N, Kositratana W, Piluek K, Shrestha SK, 1997. Effect of chemical and soil amendment for the control of bacterial wilt of potato in Nepal caused by Ralstonia solanacearum. Kasetsart Journal, Natural Sciences, 31(4):497-509; 26 ref

                                                                                                                                                                                    Dinesh Singh, Shweta Sinha, Yadav, D. K., Garima Chaudhary, 2014. Detection of Ralstonia solanacearum from asymptomatic tomato plants, irrigation water, and soil through non-selective enrichment medium with hrp gene-based bio-PCR. Current Microbiology, 69(2), 127-134. doi: 10.1007/s00284-014-0566-z

                                                                                                                                                                                    Dongfang Z, Yujun T, Zeyong X, 1994. Survival of Pseudomonas solanacearum in peanut seeds. ACIAR Bacterial Wilt Newsletter, 10:8-9

                                                                                                                                                                                    Dubey SC, 2005. Integrated management of bacterial wilt of tomato. Plant Disease Research (Ludhiana), 20(1):52-54

                                                                                                                                                                                    Echandi E, 1991. Bacterial wilt. In: Shew HD, Lucas GB, eds. Compendium of Tobacco Diseases. St. Paul, Minnesota, USA: American Phytopathological Society, 33-35

                                                                                                                                                                                    Eden-Green SJ, 1994. Diversity of Pseudomonas solanacearum and related bacteria in South-East Asia: New directions for Moko disease. In: Bacterial wilt: the disease and its causative agent, Pseudomonas solanacearum (Eds Hayward AC, Hartman GL) Wallingford, Oxon: CAB International, 25-34

                                                                                                                                                                                    Elhalag, K., Nasr-Eldin, M., Hussien, A., Ahmad, A., 2018. Potential use of soilborne lytic Podoviridae phage as a biocontrol agent against Ralstonia solanacearum. Journal of Basic Microbiology, 58(8), 658-669. https://onlinelibrary.wiley.com/journal/15214028

                                                                                                                                                                                    Elliot C, 1951. Manual of Bacterial Plant Pathogens, 2nd edition. Waltham, Massachusetts, USA: Chronica Botanica Company

                                                                                                                                                                                    Elphinstone J, Harris L, 2002. Monitoring and control of the potato brown rot bacterium in irrigation water. Oxford, UK: British Potato Council, 2 pp

                                                                                                                                                                                    Elphinstone JG, 1989. Estimating yield losses in potato due to bacterial wilt caused by Pseudomonas solanacearum. Tropical Agriculture Research Series, No. 22:120-130

                                                                                                                                                                                    Elphinstone JG, 1996. Survival and possibilities for extinction of Pseudomonas solanacearum (Smith) Smith in cool climates. Potato Research, 39(Extra edition):403-410; 27 ref

                                                                                                                                                                                    Elphinstone JG, Hennessey JK, Wilson JK, Stead DE, 1996. Sensitivity of different methods for the detection of Pseudomonas solanacearum (Smith) Smith in potato tuber extracts. Bulletin OEPP/EPPO Bulletin, 26:663-678

                                                                                                                                                                                    Elphinstone JG, Stanford HM, Stead DE, 1998. Detection of Ralstonia solanacearum in potato tubers, Solanum dulcamara, and associated irrigation water. In: Prior P, Allen C, Elphinstone J (eds) Bacterial Wilt Disease: Molecular and Ecological Aspects. Berlin, Germany: Springer publishing, 133-139

                                                                                                                                                                                    Engelbrecht MC, 1994. Modification of a semi-selective medium for the isolation and quantification of Pseudomonas solanacearum. Bacterial Wilt Newsletter, 10:3-5

                                                                                                                                                                                    Englebrecht MC, Hattingh MJ, 1989. Numerical analysis of phenotypic features of Pseudomonas solanacearum strains isolated from tobacco and other hosts in South Africa. Plant Disease, 73(11):893-898

                                                                                                                                                                                    EPPO, 1990. Quarantine procedure No. 26. Pseudomonas solanacearum. Inspection and test methods. Bulletin OEPP, 20(2):255-262

                                                                                                                                                                                    EPPO, 1990. Specific quarantine requirements. EPPO Technical Documents, No. 1008. Paris, France: European and Mediterranean Plant Protection Organization

                                                                                                                                                                                    EPPO, 1992. Quarantine pests for Europe. Wallingford, UK: CAB International, 210-212

                                                                                                                                                                                    EPPO, 2014. PQR database. Paris, France: European and Mediterranean Plant Protection Organization. http://www.eppo.int/DATABASES/pqr/pqr.htm

                                                                                                                                                                                    EPPO, 2018. PM 7/21 (2) Ralstonia solanacearum, R. pseudosolanacearum and R. syzygii (Ralstonia solanacearum species complex). Bulletin OEPP/EPPO Bulletin, 48(1), 32-63. doi: 10.1111/epp.12454

                                                                                                                                                                                    Estelitta S, Nair PV, Vilasini TN, Jayasree Sankar, 1997. Moringa oleifera Lam. - a new host of Ralstonia (Pseudomonas) solanacearum E. F. Smith from India. Bacterial Wilt Newsletter, No. 14:6

                                                                                                                                                                                    Farag N, Stead DE, Janse JD, 1999. Ralstonia (Pseudomonas) solanacearum race 3, biovar 2, detected in surface (irrigation) water in Egypt. Journal of Phytopathology, 147(7/8):485-487; 10 ref

                                                                                                                                                                                    Farag NS, Fawzi FG, El-Said SIA, Mikhail MS, 1986. Streptomycin in relation to potato brown rot control. Acta Phytopathologica et Entomologica Hungarica, 21:115-122

                                                                                                                                                                                    Farag NS, Lashin SM, Abdel-All RS, Shatta HM, Seif-Elyazal AM, 1982. Antibiotics and control of potato black leg and brown rot diseases. Agricultural Research Review, 60(2):149-166

                                                                                                                                                                                    Fegan M, Prior P, 2006. Diverse members of the Ralstonia solanacearum species complex cause bacterial wilts of bananas. Australasian Plant Pathology, 35(2):93-101. http://www.publish.csiro.au/nid/39/paper/AP05105.htm

                                                                                                                                                                                    Fegan, M., Prior, P., 2005. How complex is the "Ralstonia solanacearum species complex"?. In: Bacterial wilt disease and the Ralstonia solanacearum species complex, [ed. by Allen, C., Prior, P., Hayward, A. C.]. St. Paul, USA: American Phytopathological Society (APS Press). 449-461.

                                                                                                                                                                                    Fernandez M C, 1986. Some hosts of Pseudomonas solanacearum in Chile. (Algunos hospedantes de Pseudomonas solanacearum en Chile.) Agricultura Tecnica, Chile, 46(1):101-105

                                                                                                                                                                                    Fortnum BA, Gooden D, 2008. Transmission and survival of Ralstonia solanacearum on tobacco machinery. Beiträge zur Tabakforschung International, 23(3):137-143. http://www.beitraege-bti.de

                                                                                                                                                                                    Freire Fdas CO, Mosca JL, 2009. Diseases of flowers and ornamental plants in Ceará State, Brazil. (Patógenos associados a doenças de plantas ornamentals no Estado do Ceará.) Revista Brasileira de Horticultura Ornamental, 15(1):83-89. http://www.sbfpo.com.br

                                                                                                                                                                                    French ER, 1985. Multiple disease resistance in potato cultivars with Solanum phureja and S. demissum background. Phytopathology, 75:1288

                                                                                                                                                                                    French ER, Sequeira L, 1968. Bacterial wilt or moko of plantain in Peru. Fitopatologia, 3:27-38

                                                                                                                                                                                    Furusawa, A., Uehara, T., Ikeda, K., Sakai, H., Tateishi, Y., Sakai, M., Nakaho, K., 2019. Ralstonia solanacearum colonization of tomato roots infected by Meloidogyne incognita. Journal of Phytopathology, 167(6), 338-343. doi: 10.1111/jph.12804

                                                                                                                                                                                    Gabriel DW, Allen C, Schell M, Denny TP, Greenberg JT, Duan YP, Flores-Cruz Z, Huang Q, Clifford JM, Presting G, González ET, Reddy J, Elphinstone J, Swanson J, Yao J, Mulholland V, Liu L, Farmerie W, Patnaikuni M, Balogh B, Norman D, Alvarez A, Castillo JA, Jones J, Saddler G, Walunas T(et al), 2006. Identification of open reading frames unique to a select agent: Ralstonia solanacearum race 3 biovar 2. Molecular Plant-Microbe Interactions, 19(1):69-79. HTTP://www.APSnet.org

                                                                                                                                                                                    Gallardo PB, Panno LC, 1989. Biological control of bacterial wilt of potato induced by Pseudomonas solanacearum E.F. Smith. Revista de Microbiologia, 20:18-26

                                                                                                                                                                                    Gao G, Jin LP, Xie KY, Yan GQ, Qu DY, 2007. Bottle gourd: a new host of Ralstonia solanacearum in China. Australasian Plant Disease Notes, 2(1):151-152. http://www.publish.csiro.au/view/journals/dsp_journal_fulltext.cfm?nid=208&f=DN07059

                                                                                                                                                                                    Garcfa R, Garcfa A, Delgado L, 1999. Distribution, incidence and variability of Ralstonia solanacearum, causal agent of bacterial wilt of potato, in MTrida state, Venezuela. Bioagro, 11(1):12-23; 28 ref

                                                                                                                                                                                    Garcıa RO, Kerns JP, Thiessen L, 2019. Ralstonia solanacearum Species Complex: A Quick Diagnostic Guide. Plant Health Progress, 20, 7-13.

                                                                                                                                                                                    Gillings M, Fahy P, 1993. Genetic diversity of Pseudomonas solanacearum biovars 2 and N2 assessed using restriction endonuclease analysis of total genomic DNA. Plant Pathology, 42(5):744-753

                                                                                                                                                                                    Gillings MR, Fahy P, 1994. Genomic fingerprinting: towards a unified view of the Pseudomonas solanacearum species complex. In: Hayward AC, Hartman GL, eds. Bacterial wilt: the Disease and its Causative Agent, Pseudomonas solanacearum. Wallingford, UK: CAB International, 95-112

                                                                                                                                                                                    Gong MQ, Chen Y, Wang FZ, Chen YL, 1999. Inhibitory effect of ectomycorrhizal fungi on bacterial wilt of Eucalyptus. Forest Res. Beijing, 12:339-345

                                                                                                                                                                                    Graham J, Jones DA, Lloyd AB, 1978. Solanum cinereum, a wild host of Pseudomonas solanacearum in the deeper soil layers. Journal of the Australian Institute of Agricultural Science, 44:124-126

                                                                                                                                                                                    Graham J, Jones DA, Lloyd AB, 1979. Survival of Pseudomonas solanacearum race 3 in plant debris and in latently infected potato tubers. Phytopathology, 69:1100-1103

                                                                                                                                                                                    Graham J, Lloyd AB, 1979. Survival of potato strain (race 3) of Pseudomonas solanacearum in the deeper soil layers. Australian Journal of Agricultural Research, 30(3):489-496

                                                                                                                                                                                    Granada GA, Sequeira L, 1983. Survival of Pseudomonas solanacearum in soil, rhizosphere, and plant roots. Canadian Journal of Microbiology, 29:433-440

                                                                                                                                                                                    Grimault V, Prior P, 1993. Bacterial wilt resistance in tomato associated with tolerance of vascular tissues to Pseudomonas solanacearum. Plant Pathology, 42(4):589-594

                                                                                                                                                                                    Guinard, J., Latreille, A., Guérin, F., Poussier, S., Wicker, E., 2017. New multilocus variable-number tandem-repeat analysis (MLVA) scheme for fine-scale monitoring and microevolution-related study of Ralstonia pseudosolanacearum phylotype I populations. Applied and Environmental Microbiology, 83(5), e03095. doi: 10.1128/aem.03095-16

                                                                                                                                                                                    Gund SV, Narayan Moger, Krishnaraj PU, Ramesh Bhat, Kamanna BC, 2011. Development of race specific SCAR marker for the detection of Ralstonia solanacearum (race 2). Journal of Applied Bioscience, 37(2):91-96

                                                                                                                                                                                    Gurung TB, Vaidya AK, 1997. Baseline study report of a community participatory bacterial wilt management programme in Ulleri and Jhilibarang villages of western Nepal. Working Paper - Lumle Regional Agricultural Research Centre, No. 97/6:iii + 43 pp.; 5 ref

                                                                                                                                                                                    Hammer PA, Rane K, 1999. Southern bacterial wilt found in geraniums. GrowerTalks, 63(3):80, 82

                                                                                                                                                                                    Harris DC, 1976. Bacterial wilt in Kenya with particular reference to potatoes. In: Proceedings of the First International Planning Conference and Workshop on the ecology and control of bacterial wilt caused by Pseudomonas solanacearum [ed. by Sequeira, L.\Kelman, A.]. Raleigh, USA: North Carolina State University., 84-88

                                                                                                                                                                                    Hartman GL, Elphinstone JG, 1994. Advances in the control of Pseudomonas solanacearum race 1 in major food crops. Bacterial wilt: the disease and its causative agent, Pseudomonas solanacearum [edited by Hayward, A. C.; Hartman, G. L.] Wallingford, UK; CAB International, 157-177

                                                                                                                                                                                    Hartman GL, Hong WF, Wang TC, 1991. Survey of bacterial wilt on fresh market hybrid tomatoes in Taiwan. Plant Protection Bulletin, Taiwan, 33(2):197-203

                                                                                                                                                                                    Hartung F, Werner R, Mülbach HP, Büchner C, 1998. Highly specific PCR-diagnosis to determine Pseudomonas solanacearum strains of different geographic origins. Theroetical and Applied Genetics, 96:797-802

                                                                                                                                                                                    Hayward AC, 1964. Characteristics of Pseudomonas solanacearum. Journal of Applied Bacteriology, 27:265-277

                                                                                                                                                                                    Hayward AC, 1975. Biotypes of Pseudomonas solanacearum in Australia. Australian Plant Pathology Society Newsletter, 4(2):9-11

                                                                                                                                                                                    Hayward AC, 1983. Pseudomonas solanacearum: bacterial wilt and moko disease. In: Fahy PC, Persley GJ, eds. Plant Bacterial Diseases. Sydney, Australia: Academic Press, 129-135

                                                                                                                                                                                    Hayward AC, 1994. Systematics and phylogeny of Pseudomonas solanacearum and related bacteria. In: Hayward AC, Hartman GL, eds. Bacterial wilt: the Disease and its Causative Agent, Pseudomonas solanacearum. Wallingford, UK: CAB International, 123-135

                                                                                                                                                                                    Hayward AC, 1994. The hosts of Pseudomonas solanacearum. In: Hayward AC, Hartman GL, eds. Bacterial wilt: The Disease and its Causative Agent, Pseudomonas solanacearum. Wallingford, UK: CAB International, 9-24

                                                                                                                                                                                    Hayward AC, Fegan M, 2001. Epidemiology detection and control of brown rot of potato in temperate regions. In: Proceedings of the 2nd Australasian Soilborne Diseases Symposium, Lorne, 2001 [ed. by Porter, I. J.]. 171-173

                                                                                                                                                                                    Hayward AC, Moffett ML, 1978. Leaf spot on Capsicum and tomato caused by Pseudomonas solanacearum. Plant Disease Reporter, 62:75-78

                                                                                                                                                                                    Hayward AC, Waterston JM, 1964. Pseudomonas solanacearum. CMI Descriptions of Pathogenic Fungi and Bacteria. No. 15. Wallingford, UK: CAB International

                                                                                                                                                                                    Hazarika DK, Das KK, 1999. Incidence of bacterial wilt of Sesamum in relation to different sowing dates and variaties. Pl. Dis. Res., 14:130-133

                                                                                                                                                                                    He Kai, Yang ShuiYing, Li Hong, Wang Han, Li ZhenLun, 2014. Effects of calcium carbonate on the survival of Ralstonia solanacearum in soil and control of tobacco bacterial wilt. European Journal of Plant Pathology, 140(4), 665-675. doi: 10.1007/s10658-014-0496-4

                                                                                                                                                                                    He LY, 1986. Bacterial wilt disease in Asia and the South Pacific. In: Proceedings of an International Workshop held at PCARRD, Los Baños, Philippines, 8-10 October 1985, Canberra, ACIAR Proceedings, 13 [ed. by Persley, G. J.]. 40-48

                                                                                                                                                                                    Hong JC, Momol MT, Jones JB, Ji PS, Olson SM, Allen C, Perez A, Prakash P, Guven K, 2008. Detection of Ralstonia solanacearum in irrigation ponds and aquatic weeds associated with the ponds in North Florida. Plant Disease, 92(12):1674-1682. HTTP://www.apsnet.org

                                                                                                                                                                                    Hong JC, Norman DJ, Reed DL, Momol MT, Jones JB, 2012. Diversity among Ralstonia solanacearum strains isolated from the southeastern United States. Phytopathology, 102(10):924-936. http://apsjournals.apsnet.org/loi/phyto

                                                                                                                                                                                    Hong NX, Mehan VK, Ly NT, Vinh MT, 1994. Status of groundnut bacterial wilt research in Vietnam. Groundnut bacterial wilt in Asia. Proceedings of the third working group meeting 4-5 July 1994, Oil Crops Research Institute, Wuhan, China [edited by Mehan, V. K.; McDonald, D.] Patancheru, India; International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), 135-141

                                                                                                                                                                                    Horita K, Tsuchiya A, Ooshiro M, 2005. Characteristics of Ralstonia solanacearum Biovar N2 strains in Asia. Journal of Phytopathology, 153:209-213

                                                                                                                                                                                    Hseu SH, Huang JH, Chiou YS, 2007. Application of drainage on disease management of water spinach bacterial wilt caused by Ralstonia solanacearum. Plant Pathology Bulletin, 16(4):231-234. http://www.pp.nchu.edu.tw/cpps/index.htm

                                                                                                                                                                                    Huang, Q., Lakshman, D. K., 2010. Effect of clove oil on plant pathogenic bacteria and bacterial wilt of tomato and geranium. Journal of Plant Pathology, 92(3), 701-707. http://www.sipav.org/main/jpp/volumes/0310/031015.pdf

                                                                                                                                                                                    Hyde KD, McCulloch B, Akiew E, Peterson RA, Diatloff A, 1992. Strategies used to eradicate bacterial wilt of Heliconia (race 2) in Cairns, Australia, following introduction of the disease from Hawaii. Australasian Plant Pathology, 21(1):29-31

                                                                                                                                                                                    IPPC, 2006. Occurrence of the moko disease in Jamaica. IPPC Official Pest Report, No. JM-1/1. Rome, Italy: FAO. https://www.ippc.int/IPP/En/default

                                                                                                                                                                                    IPPC, 2007. Potato brown rot and bacterial wilt of tomato. IPPC Official Pest Report, No. TR-1/1. Rome, Italy: FAO. https://www.ippc.int/IPP/En/default

                                                                                                                                                                                    IPPC, 2007. Potato brown rot and bacterial wilt of tomato. IPPC Official Pest Report, No. VC-1/1. Rome, Italy: FAO. https://www.ippc.int/IPP/En/default

                                                                                                                                                                                    IPPC, 2010. Potato brown rot outbreak. IPPC Official Pest Report, No. GBR-22/1. Rome, Italy: FAO. https://www.ippc.int/

                                                                                                                                                                                    IPPC, 2013. Ralstonia solanacearum is absent in Denmark. IPPC Official Pest Report, No. DNK-08/2. Rome, Italy: FAO. https://www.ippc.int/

                                                                                                                                                                                    IPPC, 2015. Potato brown rot outbreak. IPPC Official Pest Report, No. GBR-01/6. Rome, Italy: FAO. https://www.ippc.int/en/

                                                                                                                                                                                    IPPC, 2016. Information on Pest Status in the Republic of Lithuania in 2015. IPPC Official Pest Report, No. LTU-01/2. Rome, Italy: FAO. https://www.ippc.int/

                                                                                                                                                                                    Janse JD, 1988. A detection method for Pseudomonas solanacearum in symptomless potato tubers and some data on its sensitivity and specificity. Bulletin OEPP, 18(3):343-351; 20 ref

                                                                                                                                                                                    Janse JD, 1991. Infra- and intraspecific classification of Pseudomonas solanacearum strains, using whole cell fatty acid analysis. Systematic and Applied Microbiology, 14(4):335-345

                                                                                                                                                                                    Janse JD, 1996. Potato brown rot in western Europe - history, present occurrence and some remarks on possible origin, epidemiology and control strategies. Bulletin OEPP, 26(3/4):679-695; 109 ref

                                                                                                                                                                                    Janse JD, 2012. Review on brown rot (Ralstonia solanacearum Race 3, biovar 2, phylotype IIb. Epidemiology and control in the Netherlands since 1995: a success story of integrated pest management. Journal of Plant Pathology, In Press

                                                                                                                                                                                    Janse JD, Arulappan FAX, Schans J, Wenneker M, Westerhuis W, 1998. Experiences with bacterial brown rot Ralstonia solanacearum biovar 2, race 3 in The Netherlands. In: Prior P, Allen C, Elphinstone J (eds) Bacterial Wilt Disease: Molecular and Ecological Aspects. Berlin, Germany: Springer publishing, 146-152

                                                                                                                                                                                    Janse JD, Beld HEvan den, Elphinstone J, Simpkins S, Tjou-Tam-Sin NNA, Vaerenbergh Jvan, 2004. Introduction to Europe of Ralstonia solanacearum biovar 2, race 3 in Pelargonium zonale cuttings. Journal of Plant Pathology, 86(2):147-155

                                                                                                                                                                                    Janse JD, Goossens E, Beuningen AEvan, Gaisch K, Tjon Tam Sin NNA, 2006. Begonia elatior, a new host for Ralstonia solanacearum race 1, biovar 1. In: Proceedings of the 4th International Bacterial Wilt Symposium, 17th-20th July 2006, The Lakeside Conference Centre. Programme and Abstracts Book. York, UK: Central Science Laboratory, 32

                                                                                                                                                                                    Ji PS, Allen C, Sanchez-Perez A, Yao J, Elphinstone JG, Jones JB, Momol MT, 2007. New diversity of Ralstonia solanacearum strains associated with vegetable and ornamental crops in Florida. Plant Disease, 91(2):195-203. HTTP://www.apsnet.org

                                                                                                                                                                                    Kelman A, 1953. The bacterial wilt caused by Pseudomonas solanacearum. A literary review and bibliography. Technical Bulletin of North Carolina Agricultural Experiment Station, No. 99

                                                                                                                                                                                    Kelman A, 1954. The relationship of pathogenicity of Pseudomonas solanacearum to colony appearance in tetrazolium medium. Phytopathology, 44:693-695

                                                                                                                                                                                    Kelman A, Hartman GL, Hayward AC, 1994. Introduction. In: Hayward AC, Hartman GL, eds. Bacterial wilt: the Disease and its Causative Agent, Pseudomonas solanacearum. Wallingford, UK: CAB International, 1-7

                                                                                                                                                                                    Keshwal RL, Khare UK, Singh RP, 2000. Effect of physical properties of soil on wilt incidence and population of Ralstonia solanacearum. Ann. Pl. Prot. Sci., 8:40-43

                                                                                                                                                                                    Kheirandish, Z., Harighi, B., 2015. Evaluation of bacterial antagonists of Ralstonia solanacearum, causal agent of bacterial wilt of potato. Biological Control, 86, 14-19. doi: 10.1016/j.biocontrol.2015.03.007

                                                                                                                                                                                    Khoodoo MHR, Ganoo ES, Saumtally S, 2007. First report of Ralstonia solanacearum race 3, biovars 2A infecting potato and weeds in Mauritius. Plant Disease, 91:1200

                                                                                                                                                                                    Kim SH, Olson RN, Schaad N, 2002. Ralstonia solanacearum Biovar 2, Race 3 in geraniums imported from Guatemala to Pennsylvania in 1999. Plant Disease, 92:S42

                                                                                                                                                                                    Kim SH, Olson TN, Schaad NW, Moorman GW, 2003. Ralstonia solanacearum race 3, biovar 2, the causal agent of brown rot of potato, identified in geraniums in Pennsylvania, Delaware, and Connecticut. Plant Disease, 87(4):450

                                                                                                                                                                                    Kim, S. H., Olson, T. N., Schaad, N. W., Moorman, G. W., 2003. Ralstonia solanacearum race 3, biovar 2, the causal agent of brown rot of potato, identified in geraniums in Pennsylvania, Delaware, and Connecticut. Plant Disease, 87(4), 450. doi: 10.1094/PDIS.2003.87.4.450C

                                                                                                                                                                                    Kishore V, Shekhawat GS, Sunaina V, 1996. Cultural practices to reduce Pseudomonas solanacearum in the infested soil. J. Indian Potato Assoc., 23:130-133

                                                                                                                                                                                    Kishun R, Sohi HS, Rao MVB, 1980. Two new collateral hosts for Pseudomonas solanacearum. Current Science, 49(16):639

                                                                                                                                                                                    Klykov AP, 1951. Bacteriosis of the cotyledons of soybeans and its control. Mikrobiologia, 20:33-40

                                                                                                                                                                                    Klykov AP, 1963. Bacterial diseases of soybean. Zashch. Rast. Moskva, 8:35-36

                                                                                                                                                                                    Krasnova MV, 1963. The effect of some physical factors on the causal agents of bacterioses in soybean seeds. J. Microbiol. Kiev, 25:50-52

                                                                                                                                                                                    Lee J, Park TH, 2016. Isolation and Characterization of Bacteriophages Infecting Ralstonia solanacearum from Potato Fields. Res. Plant Dis, 22(4), 236-242.

                                                                                                                                                                                    Lelliott RA, Stead DE, 1987. Methods for the diagnosis of bacterial diseases of plants. Oxford, UK: Blackwell Scientific Publications, 216 pp

                                                                                                                                                                                    Lemessa F, Zeller W, 2006. Biological control of potato bacterial wilt caused by Ralstonia solanacearum in Ethiopia: determination of biovars of Ralstonia solanacearum. Mitteilungen aus der Biologischen Bundesanstalt für Land- und Forstwirtschaft [Proceedings of the 1st International Symposium on Biological Control of Bacterial Plant Diseases, Seeheim, Darmstadt, Germany, 23-26 October, 2005.], No.408:119-120

                                                                                                                                                                                    Lenarčič, R., Morisset, D., Pirc, M., Llop, P., Ravnikar, M., Dreo, T., 2014. Loop-mediated isothermal amplification of specific endoglucanase gene sequence for detection of the bacterial wilt pathogen Ralstonia solanacearum. PLoS ONE, 9(4), e96027. doi: 10.1371/journal.pone.0096027

                                                                                                                                                                                    Li Peng, Zhou HengCang, Wu XingXing, Wang ZhiYuan, Ho HH, Wu YiXin, Mao ZiChao, He YueQiu, 2012. First record and description of Ralstonia solanacearum wilt in patchouli from Yunnan Province, China. Indian Phytopathology, 65(2):208-210. http://epubs.icar.org.in/ejournal/index.php/IPPJ

                                                                                                                                                                                    Li Z, Wu S, Bai X, Liu Y, Lu J, Liu Y, Xiao B, Lu X, Fan L, 2011. Genome sequence of the tobacco bacterial wilt pathogen Ralstonia solanacearum. Journal of Bacteriology, 193:6088-6089

                                                                                                                                                                                    Liao BS, Jiang RW, Tan YJ, Rao RH, Tang GY, 1992. A study on nitrogen-fixation in some groundnut lines resistant to bacterial wilt. Oil Crops of China, No. 4:34-37

                                                                                                                                                                                    Liao BS, Shan ZH, Lei Y, Tan YJ, Li D, Duan NX, 1998. Reaction of groundnut (Arachis hypogaea) to latent infection by bacterial wilt (Ralstonia solanacearum L.). Chinese J. Oil Crop Sci., 20:66-70

                                                                                                                                                                                    Liao YM, Nong YX, Zhou ZQ, 2008. First report Emilia sonchifolia wilt caused by Ralstonia solanacearum. Guihaia, 28:531-533

                                                                                                                                                                                    Lin CH, Chuang MH, Wang JF, 2015. First report of bacterial wilt caused by Ralstonia solanacearum on chard in Taiwan. Plant Disease, 99(2):282. http://apsjournals.apsnet.org/loi/pdis

                                                                                                                                                                                    Lin JC, Hsu ST, Tzeng KC, 1999. Weed hosts of Ralstonia solanacearum in Taiwan. Plant Protection Bulletin (Taipei), 41(4):277-292

                                                                                                                                                                                    Long LiQin, Sang WeiJun, Diao ChaoQiang, Yang MaoFa, Luo ZhenYou, Rao YinYong, Chen SenYu, 2008. A preliminary report on tobacco root and stem diseases in Hezhang County, Guizhou. Guizhou Agricultural Sciences, No.4:103-105

                                                                                                                                                                                    Lopes CA, Poltronieri LS, Albuquerque FC, Trindade DR, 1998. Piper hispidinervium, a new host of bacterial wilt. Bacterial Wilt Newsletter, No. 15:4

                                                                                                                                                                                    Lopes, C. A., Rossato, M., 2018. History and status of selected hosts of the Ralstonia solanacearum species complex causing bacterial wilt in Brazil. Frontiers in Microbiology, 9(June), 1228. doi: 10.3389/fmicb.2018.01228

                                                                                                                                                                                    Lopes, C. A., Rossato, M., Boiteux, L. S., 2015. The host status of coffee (Coffea arabica) to Ralstonia solanacearum phylotype I isolates. Tropical Plant Pathology, 40(1), 1-4. doi: 10.1007/s40858-014-0001-9

                                                                                                                                                                                    Lopez R, Fonseca J, Torres B, 1978. Use of resistant cultivars to control soil bacterial wilt of tobacco in regions of Costa Rica. Fitopatologia, 13(2):103-106

                                                                                                                                                                                    Loreti S, Fiori M, Simone Dde, Falchi G, Gallelli A, Schiaffino A, Ena S, 2008. Bacterial wilt, caused by Ralstonia solanacearum, on tomato in Italy. Plant Pathology, 57(2):368. http://www.blackwell-synergy.com/doi/full/10.1111/j.1365-3059.2007.01729.x

                                                                                                                                                                                    Lum KY, Wong HK, 1976. Control of bacterial wilt of tomatoes in the lowlands through grafting. MARDI Research Bulletin, 4(1):28-33

                                                                                                                                                                                    Maas JL, Galletta GJ, 1997. Recent progress in strawberry disease research. Acta Horticulturae, No. 439, II:769-779; 58 ref

                                                                                                                                                                                    Machmud M, 1993. Present status of groundnut bacterial wilt research in Indonesia. Groundnut bacterial wilt. Proceedings of the Second Working Group Meeting, 2 Nov. 1992, Asian Vegetable Research and Development Center, Tainan, Taiwan [edited by Mehan, V. K.; Hayward, A. C.] Patancheru, India; International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), 15-24

                                                                                                                                                                                    Machmud M, Middleton KJ, 1990. Seed infection and transmission of Pseudomonas solanacearum on groundnut. ACIAR Proceedings Series, No. 31:57

                                                                                                                                                                                    Machmud M, Middleton KJ, 1991. Transmission of Pseudomonas solanacearum through groundnut seeds. Bacterial Wilt Newsletter, 7:4-5

                                                                                                                                                                                    Martin C, French E, 1995. Covered-field host range test for Pseudomonas solanacearum race 3/biovar 2. Bacterial Wilt Newsletter, No. 12:9

                                                                                                                                                                                    Martin C, Nydegger U, 1982. Susceptibility of Cyphomandra betaceae to Pseudomonas solanacearum. Plant Disease, 66:1025-1027

                                                                                                                                                                                    Mateo N, Aguilar D, Fiallos W, Trejo J, Salgado J, 1982. Effect of fallow periods on the yield and the incidence of Pseudomonas solanacearum on potato in Honduras. Fitopatologia, 17(1):24-29

                                                                                                                                                                                    Mathew J, Mathew SK, Radhakrishnan VV, Beena S, 1994. Bacterial wilt of patchouli (Pogostemon patchouli L.) caused by Pseudomonas solanacearum (Smith) Smith. Bacterial Wilt Newsletter, No. 11:10

                                                                                                                                                                                    McCarter SM, 1991. Bacterial wilt. In: Jones JB, Jones JP, Stall RE, Zitter TA, eds. Compendium of Tomato Diseases. St. Paul, Minnesota, USA: American Phytopathological Society, 28-29

                                                                                                                                                                                    Melo Ms de, Furuya N, Iiyama K, Matsuyama N, 1999. Geographical distribution of biovars of Ralstonia solanacearum in Brazil. J. Fac. Agric. Kyushu Univ., 44:9-15

                                                                                                                                                                                    Melton TA, Powell NT, 1991. Effects of two-year crop rotations and cultivar resistance on bacterial wilt in flue-cured tobacco. Plant Disease, 75(7):695-698

                                                                                                                                                                                    Mepharishvili G, Sikharulidze Z, Thwaites R, Tsetskhladze T, Dumbadze R, Gabaidze M, Muradashvili M, 2012. First confirmed report of bacterial wilt of tomato in Georgia caused by Ralstonia solanacearum. New Disease Reports, 25:16. http://www.ndrs.org.uk/article.php?id=025016

                                                                                                                                                                                    Messiha NAS, Diepeningen ADvan, Farag NS, Abdallah SA, Janse JD, Bruggen AHCvan, 2007. Stenotrophomonas maltophilia: a new potential biocontrol agent of Ralstonia solanacearum, causal agent of potato brown rot. European Journal of Plant Pathology, 118(3):211-225. http://springerlink.metapress.com/link.asp?id=100265

                                                                                                                                                                                    Michel VV, Hartman GL, Midmore DJ, 1996. Effect of previous crop on soil populations of Burkholderia solanacearum, bacterial wilt, and yield of tomatoes in Taiwan. Plant Disease, 80(12):1367-1372; 34 ref

                                                                                                                                                                                    Michel VV, Mew TW, 1998. Effect of a soil amendment on the survival of Ralstonia solanacearum in different soils. Phytopathology, 88(4):300-305; 40 ref

                                                                                                                                                                                    Milijasevic-Marcic S, Todorovic B, Potocnik I, Rekanovic E, Stepanovic M, Mitrovic J, Duduk B, 2013. Ralstonia solanacearum - a new threat to potato production in Serbia. Pesticidi i Fitomedicina, 28(4):229-237. http://www.pesting.org.rs/

                                                                                                                                                                                    Mochizuki H, Yamakawa K, 1979. Potential utilization of bacterial-wilt resistant Solanum species as rootstock for commercial eggplant production. Bulletin of the Vegetable and Ornamental Crops Research Station, A (Ishinden-Ogoso), No.6:11-18

                                                                                                                                                                                    Moffett ML, Wood BA, Hayward AC, 1981. Seed and soil: sources of inoculum for the colonisation of the foliage of solanaceous hosts by Pseudomonas solanacearum. Annals of Applied Biology, 98(3):403-411

                                                                                                                                                                                    Mohamed Ali MI, Anuratha CS, Sharma JK, 1991. Bacterial wilt of Causuarina equisetifolia in India. European Journal of Forest Pathology, 21:234-238

                                                                                                                                                                                    Mondal B, Sunita Mahapatra, Khatua DC, 2012. Records of some new diseases of horticultural plants of West Bengal. Journal of Interacademicia, 16(1):36-43

                                                                                                                                                                                    Moraes MAde, 1947. A vascular disease of potato (Bacterium solanacearum) E.F.Smith. (Uma bacteriose vascular da batateira (Bacterium solanacearum) E.F. Smith.) Agronomia Lusitana, 9:277-328

                                                                                                                                                                                    Mori, T., Inada, T., Ogawa, K., Matsusaki, H., Matsuzoe, N., 2012. Phenotypic conversion of Ralstonia solanacearum in water extract of Solanum toxicarium. Journal of Plant Pathology, 94(3), 535-542. http://sipav.org/main/jpp/index.php/jpp/issue/view/124

                                                                                                                                                                                    Mulya K, Shiomi T, Oniki M, 1992. Bacterial wilt disease on industrial crops in Indonesia. Indonesian Crops Research Journal, 2:30-36

                                                                                                                                                                                    Murakoshi S, Takahashi M, 1984. Trials of some control of tomato bacterial wilt caused by Pseudomonas solanacearum. Bulletin of the Kanagawa Horticultural Experiment Station, No.31:50-56

                                                                                                                                                                                    Muras VA, 1963. On bacterial wilt of soybeans in the Ukraine. J. Microbiol. Kiev, 25:42-49

                                                                                                                                                                                    Muras VA, 1964. Bacterial diseases of soybean and their causal agents. Ref. Zh. Rasten, 14:464

                                                                                                                                                                                    Müller P, Parusel R, 1998. Investigation and control of potato brown rot in germany, especially in Bayern. Bull. OEPP/EPPO Bull., 28:519-524

                                                                                                                                                                                    Nesmith WC, Jenkins SF Jr, 1985. Influence of antagonists and controlled matric potential on the survival of Pseudomonas solanacearum in four North Carolina soils. Phytopathology, 75(11):1182-1187

                                                                                                                                                                                    N'Guessan, C. A., Brisse, S., Roux-Nio, A. C. le, Poussier, S., Koné, D., Wicker, E., 2013. Development of variable number of tandem repeats typing schemes for Ralstonia solanacearum, the agent of bacterial wilt, banana Moko disease and potato brown rot. Journal of Microbiological Methods, 92(3), 366-374. doi: 10.1016/j.mimet.2013.01.012

                                                                                                                                                                                    Nguyen, M. T., Ranamukhaarachchi, S. L., 2010. Soil-borne antagonists for biological control of bacterial wilt disease caused by Ralstonia solanacearum in tomato and pepper. Journal of Plant Pathology, 92(2), 395-406. http://www.sipav.org/main/jpp/

                                                                                                                                                                                    Niepold F, 1999. Efficiency surveys of the peracids Degaclean and Clarmarin in combination with the catalase inhibitor KH10 from the Degussa company for eradicating the two quarantine bacteria Clavibacter michiganensis ssp. sepedonicus and Ralstonia solanacearum in an aqueous suspension and in the sewage water of the starch industry. Journal of Phytopathology, 147(11-12):625-634; 25 ref

                                                                                                                                                                                    Nikitina KV, 1974. Infection of clover seeds by the pathogens of bacterial blight. Trudy po Prikladnoi Botanike, Genetike I Selektsii, 51:221-227

                                                                                                                                                                                    Nikitina KV, Korsakov NI, 1978. Bacterial diseases of soybean in the Soviet Far East and in southern regions of the USSR: search for sources of resistance to them. Trudy po Prikladnoi Botanike, Genetike i Selektsii, 62:13-18

                                                                                                                                                                                    Norman DJ, Yuen JMF, 1998. A distinct pathotype of Ralstonia (Pseudomonas) solanacearum race 1, biovar 1 entering Florida in pothos (Epipremnum aureum) cuttings. Canadian Journal of Plant Pathology, 20(2):171-175

                                                                                                                                                                                    Norman DJ, Yuen JMF, 1999. First report of Ralstonia (Pseudomonas) solanacearum infecting pot Anthurium production in Florida. Plant Disease, 83(3):300

                                                                                                                                                                                    Norman DJ, Zapata M, Gabriel DW, Duan YP, Yuen JMF, Mangravita-Novo A, Donahoo RS, 2009. Genetic diversity and host range variation of Ralstonia solanacearum strains entering North America. Phytopathology, 99(9):1070-1077. http://www.apsnet.org/phyto/

                                                                                                                                                                                    Nyangeri JB, Gathuru EM, Mukunya DM, 1984. Effect of latent infection on the spread of bacterial wilt of potatoes in Kenya. Tropical Pest Management, 30:163-165

                                                                                                                                                                                    OEPP/EPPO, 1961. Bacterial diseases of potato. Report of the International Conference on Corynebacterium sepedonicum and Pseudomonas solanacearum. EPPO Publications Series A No. 31

                                                                                                                                                                                    O'Hern C, 2004. Detection of Ralstonia solanacearum race 3 biovar 2 in New York Greenhouse (document by Richard Dunkle) [Distribution list]

                                                                                                                                                                                    Okiro LA, Tancos MA, Nyanjom SG, Smart CD, Parker ML, 2019. Comparative Evaluation of LAMP, qPCR, Conventional PCR, and ELISA to Detect Ralstonia solanacearum in Kenyan Potato Fields. Plant Disease, 103, 959-965.

                                                                                                                                                                                    Olsson K, 1976. Overwintering of Pseudomonas solanacearum in Sweden. In: Sequeira L, Kelman A, ed. Proceedings of the First International Planning Conference and Workshop on the ecology and control of bacterial wilt caused by Pseudomonas solanacearum. North Carolina State University. Raleigh USA, 105-109

                                                                                                                                                                                    Ono K, Hara H, Akazawa J, 1984. Ecological studies on the bacterial wilt of tobacco, caused by Pseudomonas solanacearum E.F. Smith. V. The movement of the pathogen in tobacco plants. Bulletin of the Okayama Tobacco Experiment Station, No.43:41-46

                                                                                                                                                                                    Opina N, Tavner F, Hollway G, Wang JF, Li TH, Maghirang R, Fegan M, Hayward AC, Krishnapillai V, Hong WF, Holloway BW, Timmis JN, 1997. A novel method for development of species and strain-specific DNA probes and PCR primers for identifying Burkholderia solanacearum (formerly Pseudomonas solanacearum). Asia. Pacific. J. Mol. Biol. Biotechnol. , 5, 19-30.

                                                                                                                                                                                    Pan CM, Lin YS, Hsu ST, 1996. Bacterial wilt, a new disease of loofah caused by Pseudomonas solanacearum. Plant Protection Bulletin (Taipei), 38(4):295-312

                                                                                                                                                                                    Paret ML, Silva ASde, Criley RA, Alvarez AM, 2008. Ralstonia solanacearum race 4: risk assessment for edible ginger and floricultural ginger industries in Hawaii. HortTechnology, 18(1):90-96. http://horttech.ashspublications.org/

                                                                                                                                                                                    Parkinson, N., Bryant, R., Bew, J., Conyers, C., Stones, R., Alcock, M., Elphinstone, J., 2013. Application of variable-number tandem-repeat typing to discriminate Ralstonia solanacearum strains associated with english watercourses and disease outbreaks. Applied and Environmental Microbiology, 79(19), 6016-6022. doi: 10.1128/AEM.01219-13

                                                                                                                                                                                    Pasqua di Bisceglie, D., Saccardi, A., Giosue, S., Traversa, F., Mazzucchi, U., 2005. Survival of Ralstonia solanacearum on wood, high density polyethylene and on jute fabric in cold storage. Journal of Plant Pathology, 87(2), 145-147.

                                                                                                                                                                                    Pathak KN, Roy S, Ojha KL, Jha MM, 1999. Influence of Meloidogyne incognita on the fungal and bacterial wilt complex of banana. Indian J. Nem., 29:39-43

                                                                                                                                                                                    Perez AS, Mejia L, Fegan M, Allen C, 2008. Diversity and distribution of Ralstonia solanacearum strains in Guatemala and rare occurrence of tomato fruit infection. Plant Pathology, 57(2):320-331. http://www.blackwell-synergy.com/doi/full/10.1111/j.1365-3059.2007.01769.x

                                                                                                                                                                                    Persley GJ(Editor), 1985. Bacterial wilt disease in Asia and the South Pacific. Proceedings of an international workshop held at PCARRD, Los Banos, Philippines, 8-10 October 1985. Canberra, ACT, Australia; Australian Centre for International Agricultural Research, 145pp

                                                                                                                                                                                    Persley GJ, 1986. Ecology of Pseudomonas solanacearum, the causal agent of bacterial wilt. In: Persley GJ, ed. Proceedings of an International Workshop held at PCARRD, Los Banos, Philippines 8-10 October 1985. ACIAR Proceedings, 13, 71-76

                                                                                                                                                                                    Petrolini B, Quaroni S, Saracchi M, 1986. Scanning electron microscopy investigations on the relationships between bacteria and plant tissues. II. Investigations on the initial processes of Pseudomonas solanacearum pathogenesis. Rivista di Patologia Vegetale, 22:100-115

                                                                                                                                                                                    Pingsheng J, Allen C, Sanchez-Perez A, Yao J, Elphinstone J, Jones JB, Momol MT, 2007. New diversity of Ralstonia solanacearum strains associated with vegetable and ornamental crops in Florida. Plant Disease, 91:195-203

                                                                                                                                                                                    Pontes, N. de C., Kronka, A. Z., Moraes, M. F. H., Nascimento, A. S., Fujinawa, M. F., 2011. Incorporation of neem leaves into soil to control bacterial wilt of tomato. Journal of Plant Pathology, 93(3), 741-744. http://sipav.org/main/jpp/index.php/jpp/article/view/1245

                                                                                                                                                                                    Poussier S, Trigalet-Demery D, Vanderwalle P, Goffinet B, Luisetti J, Trigalet A, 2000. Genetic diversity of R. solanacearum as assessed by PCR-RFLP of the hrp gene region, AFLP and 16S rRNA sequence analysis, and identification of an African subdivision. Microbiology, 146:1679-1692

                                                                                                                                                                                    Poussier S, Vandewalle P, Luisetti J, 1999. Genetic diversity of African and worldwide strains of Ralstonia solanacearum as determined by PCR-restriction fragment length polymorphism analysis of the hrp gene region. Applied and Environmental Microbiology, 65(5):2184-2194; 47 ref

                                                                                                                                                                                    Pradhanang PM, Elphinstone JG, 1996. Identification of weed and crop hosts of Pseudomonas solanacearum race 3 in the hills of Nepal. In: Pradhanang PM, Elphinstone JG, eds. Integrated management of bacterial wilt of potato: Lessons from the hills of Nepal. Proceedings of a national workshop held at Lumle Agricultural Research Centre, Pokhara, Nepal, 4-5 November, 1996: 39-49

                                                                                                                                                                                    Pradhanang PM, Elphinstone JG, 1996. Integrated management of bacterial wilt of potato: lessons from the hills of Nepal. Proceedings of a national workshop held at Lumle Agricultural Research Centre, Nepal, 4-5 November 1996. Integrated management of bacterial wilt of potato: lessons from the hills of Nepal. Proceedings of a national workshop held at Lumle Agricultural Research Centre, Nepal, 4-5 November 1996., iv + 119 pp.; [ref. at end of individual papers]

                                                                                                                                                                                    Prior P, Steva H, Cadet P, 1990. Aggressiveness of strains of Pseudomonas solanacearum from the French West Indies (Martinique and Guadeloupe) on tomato. Plant Disease, 74(12):962-965

                                                                                                                                                                                    Prior, P., Ailloud, F., Dalsing, B. L., Remenant, B., Sanchez, B., Allen, C., 2016. Genomic and proteomic evidence supporting the division of the plant pathogen Ralstonia solanacearum into three species. BMC Genomics, 17(90), (1 February 2016). http://bmcgenomics.biomedcentral.com/articles/10.1186/s12864-016-2413-z

                                                                                                                                                                                    Quezado-Soares AM, Lopes CA, 1994. Bacterial wilt of two weed species of the family Labiatae, incited by Pseudomonas solanacearum. Bacterial Wilt Newsletter, No. 11:6

                                                                                                                                                                                    Quezado-Soares AM, Lopes CA, Buso JA, Melo PEde, 1997. Evaluation in Brazil of potato clones resistant to bacterial wilt in the Philippines. Bacterial Wilt Newsletter, No. 14:1-3; 11 ref

                                                                                                                                                                                    Rahman MA, Abdullah H, Vanhaecke M, 1999. Histopathology of susceptible and resistant Capsicum annuum cultivars infected with Ralstonia solanacearum. Journal of Phytopathology, 147(3):129-140; 34 ref

                                                                                                                                                                                    Rahman MZ, Main IH, 1996. Characterization of isolates of Pseudomonas solanacearum from Bangladesh. Bacterial Wilt Newsletter, No. 13:8; 5 ref

                                                                                                                                                                                    Rajeshwari N, Shylaja MD, Krishnappa M, Shetty HS, Mortensen CN, Mathur SB, 1998. Development of ELISA for the detection of Ralstonia solanacearum in tomato: its application in seed health testing. World Journal of Microbiology & Biotechnology, 14(5):697-704; 36 ref

                                                                                                                                                                                    Ram Kishun, 1987. Loss in yield of tomato due to bacterial wilt caused by Pseudomonas solanacearum. Indian Phytopathology, 40(2):152-155

                                                                                                                                                                                    Ravelomanantsoa, S., Robène, I., Chiroleu, F., Guérin, F., Poussier, S., Pruvost, O., Prior, P., 2016. A novel multilocus variable number tandem repeat analysis typing scheme for African phylotype III strains of the Ralstonia solanacearum species complex. PeerJ, 4(1949), e1949. https://peerj.com/articles/1949/

                                                                                                                                                                                    Remenant B, Cambiaire JCde, Cellier G, Jacobs JM, Mangenot S, Barbe V, Lajus A, Vallenet D, Medigue C, Fegan M, Allen C, Prior P, 2011. Ralstonia syzygii, the blood disease bacterium and some Asian R. solanacearum strains form a single genomic species despite divergent lifestyles. PLoS ONE, No.September:e24356. http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0024356

                                                                                                                                                                                    Robertson AE, Wechter WP, Denny TP, Fortnum BA, Kluepfel DA, 2004. Relationship between avirulence gene (avrA) diversity in Ralstonia solanacearum and bacterial wilt incidence. Molecular Plant-Microbe Interactions, 17(12):1376-1384

                                                                                                                                                                                    Rodrigues-Neto J, Malavolta VA, Hamahiga I, 1984. Sintomas atipicos em tubérculos de batata infectados por Pseudomonas solanacearum (Smith) Smith. Biologico, 50:93-95

                                                                                                                                                                                    Romero GC, Estévez de Jensen C, Palmateer AJ, 2013. First report of tomato wilt caused by Ralstonia solanacearum biovar 1 in Puerto Rico. Plant Health Progress, No.April:PHP-2013-0418-01-BR. http://www.plantmanagementnetwork.org/php/elements/sum.aspx?id=10624&photo=5938

                                                                                                                                                                                    Roopali Singh, 1994. Seed transmission studies with Pseudomonas solanacearum in tomato and eggplant. Bacterial Wilt Newsletter, 11:12-13

                                                                                                                                                                                    Saddler GS, 1994. Burkholderia solanacearum. IMI descriptions of Plant Pathogenic Fungi and Bacteria, No. 1220. Wallingford, UK: CAB International

                                                                                                                                                                                    Safni I, Cleenwerck I, De Vos P, Fegan M, Sly L, Kappler U, 2014. Polyphasic taxonomic revision of the Ralstonia solanacearum species complex: proposal to emend the descriptions of Ralstonia solanacearum and Ralstonia syzygii and reclassify current R. syzygii strains as Ralstonia syzygii subsp.syzygii subsp. nov., R. solanacearum phylotype IV strains as Ralstonia syzygii subsp. indonesiensis subsp. nov., banana blood disease bacterium strains as Ralstonia syzygii subsp. celebesensis subsp. nov. and R. solanacearum phylotype I and III strains as Ralstonia pseudosolanacearum sp. nov. Int. J. Syst. Evol. Micr, 64, 3087-3103. doi: 10.1099/ijs.0.066712-0

                                                                                                                                                                                    Santiago TR, Grabowski C, Mizubuti ESG, 2014. First report of bacterial wilt caused by Ralstonia solanacearum on Eucalyptus sp. in Paraguay. New Disease Reports, 29:2. http://www.ndrs.org.uk/article.php?id=029002

                                                                                                                                                                                    Santiago, T. R., Lopes, C. A., Caetano-Anollés, G., Mizubuti, E. S. G., 2020. Genetic Structure of Ralstonia solanacearum and Ralstonia pseudosolanacearum in Brazil. Plant Disease, 104(4), 1019-1025. doi: 10.1094/PDIS-09-19-1929-RE

                                                                                                                                                                                    Sarkar S, Chaudhuri S, 2015. New report of additional enterobacterial species causing wilt in West Bengal, India. Canadian Journal of Microbiology, 61(7):477-486. http://www.nrcresearchpress.com/doi/full/10.1139/cjm-2015-0017

                                                                                                                                                                                    Schaad NW, Jones JB, Chun W, 2001. Laboratory guide for the identification of plant pathogenic bacteria. Laboratory guide for the identification of plant pathogenic bacteria, Ed. 3:xii + 373 pp.; 24 ref

                                                                                                                                                                                    Seal SE, Elphinstone JG, 1994. Advances in identification and detection of Pseudomonas solanacearum. In: Hayward AC, Hartman GL, eds. Bacterial wilt: the Disease and its Causative Agent, Pseudomonas solanacearum. Wallingford, UK: CAB International, 35-57

                                                                                                                                                                                    Seal SE, Jackson LA, Young JPW, Daniels MJ, 1993. Differentiation of Pseudomonas solanacearum, Pseudomonas syzygii, Pseudomonas pickettii and blood disease bacterium by partial 16S rRNA sequencing: construction of oligonucleotide primers for sensitive detection by polymerase chain reaction. Journal of General Microbiology, 139:1587-1594

                                                                                                                                                                                    Seal SE, Taghavi M, Fegan N, Hayward AC, Fegan M, 1999. Determination of Ralstonia (Pseudomonas) solanacearum rDNA subgroups by PCR tests. Plant Pathology, 48(1):115-120; 25 ref

                                                                                                                                                                                    Sedighian, N, Krijger, M, Taparia, T, Taghavi, SM, Wicker, E, van der Wolf, JM, Osdaghi, E, 2020. Genome Resource of Two Potato Strains of Ralstonia solanacearum Biovar 2 (Phylotype IIB/sequevar 1) and Biovar 2T (Phylotype IIB/Sequevar 25) Isolated from lowlands in Iran. Molecular Plant-Microbe Interactions

                                                                                                                                                                                    Sequeira L, Rowe PR, 1969. Selection and utilization of Solanum phureja clones with high resistance to different strains of Pseudomonas solanacearum. American Potato Journal, 46:451-462

                                                                                                                                                                                    Sharma BK, Rana KS, 1999. Bacterial wilt: a threat to ginger cultivation in Himachal Pradesh. Plant Disease Research, 14(2):216-217; 5 ref

                                                                                                                                                                                    She XiaoMan, Yu Lin, Lan GuoBing, Tang YaFei, He ZiFu, 2017. Identification and genetic characterization of Ralstonia solanacearum species complex isolates from Cucurbita maxima in China. Frontiers in Plant Science, 8(October), 1794. doi: 10.3389/fpls.2017.01794

                                                                                                                                                                                    She XM, He ZF, Luo FF, Li HP, 2013. First report of bacterial Wilt caused by Ralstonia solanacearum on Ageratum conyzoides in China. Plant Disease, 97(3):418-419. http://apsjournals.apsnet.org/loi/pdis

                                                                                                                                                                                    Shrestha SK, 1996. Bacterial wilt of potato in Nepal: spread, losses and magnitude of disease. In: Pradhanang PM, Elphinstone JG, eds. Integrated management of bacterial wilt of potato: Lessons from the hills of Nepal. Proceedings of a national workshop held at Lumle Agricultural Research Centre, Pokhara, Nepal, 4-5 November 1996: 11-18

                                                                                                                                                                                    Sikirou R, Beed F, Ezin V, Gbèhounou G, Miller SA, Wydra K, 2009. First report of bacterial wilt of tomato (Solanum lycopersicum) caused by Ralstonia solanacearum in Benin. Plant Disease, 93(5):549. http://apsjournals.apsnet.org/loi/pdis

                                                                                                                                                                                    Sikirou R, Zocli B, Paret ML, Deberdt P, Coranson-Beaudu R, Huat J, Assogba-Komlan F, Dossoumou MEEA, Simon S, Wicker E, 2015. First report of bacterial wilt of Gboma (Solanum macrocarpon) caused by Ralstonia solanacearum in Benin. Plant Disease, 99(11):1640. http://apsjournals.apsnet.org/loi/pdis

                                                                                                                                                                                    Sikirou, R., Beed, F., Ezin, V., Hoteigni, J., Miller, S. A., 2017. Distribution, pathological and biochemical characterization of Ralstonia solanacearum in Benin. Annals of Agricultural Science (Cairo), 62(1), 83-88. doi: 10.1016/j.aoas.2017.05.003

                                                                                                                                                                                    Singh R, 1995. Seed transmission studies with Pseudomonas solanacearum in tomato and eggplant. ICIAR Bacterial Wilt Newsletter, 11:12-13

                                                                                                                                                                                    Siri MI, Sanabria A, Pianzzola MJ, 2011. Genetic diversity and aggressiveness of Ralstonia solanacearum strains causing bacterial wilt of potato in Uruguay. Plant Disease, 95(10):1292-1301. http://apsjournals.apsnet.org/loi/pdis

                                                                                                                                                                                    Sitaramaiah K, Sinha SK, 1984. Interaction between Meloidogyne javanica and Pseudomonas solanacearum on brinjal. Indian Journal of Nematology, 14:1-5

                                                                                                                                                                                    Skerman VBD, McGowan V, Sneath PHA, 1980. Approved lists of bacterial names. International Journal of Systematic Bacteriology, 30(1):255-420

                                                                                                                                                                                    Smith IM, McNamara DG, Scott PR, Holderness M, 1997. Quarantine pests for Europe. Second Edition. Data sheets on quarantine pests for the European Union and for the European and Mediterranean Plant Protection Organization. Quarantine pests for Europe. Second Edition. Data sheets on quarantine pests for the European Union and for the European and Mediterranean Plant Protection Organization., Ed. 2:vii + 1425 pp.; many ref

                                                                                                                                                                                    Smith JJ, Offord LC, Holderness M, Saddler GS, 1995. Genetic diversity of Burkholderia solanacearum (synonym Pseudomonas solanacearum) race 3 in Kenya. Applied and Environmental Microbiology, 61(12):4263-4268; 35 ref

                                                                                                                                                                                    Stefani, E., Giosuè, S., Mazzucchi, U., 2005. Detection of latent infections of Ralstonia solanacearum biovar 2, race 3 in tomato crops. Journal of Plant Pathology, 87(3), 167-171.

                                                                                                                                                                                    Stefani, E., Mazzucchi, U., 1997. Protein electrophoretograms for the identification of Ralstonia solanacearum in potato tubers. Journal of Plant Pathology, 79(3), 189-195.

                                                                                                                                                                                    Strider DL, Jones RK, Haygood RA, 1981. Southern bacterial wilt of geranium caused by Pseudomonas solanacearum. Plant Disease, 65(1):52-53

                                                                                                                                                                                    Subedi N, Gilbertson RL, Osei MK, Cornelius E, Miller SA, 2014. First report of bacterial wilt caused by Ralstonia solanacearum in Ghana, West Africa. Plant Disease, 98(6):840. http://apsjournals.apsnet.org/loi/pdis

                                                                                                                                                                                    Sunaina V, Tomar DK, 2003. Distribution of bacterial wilt of potato and its races/biovars in Uttaranchal hills. Bionotes, 5(1):13-14

                                                                                                                                                                                    Sunarjono H, 1980. Increasing tomato production - disease resistant varieties show promise. Indonesian Agric. Res. & Dev., J. 2:5-7

                                                                                                                                                                                    Swanepoel, A. E., 1990. The effect of temperature on the development of wilting and on progeny tuber infection of potatoes inoculated with South African strains of biovar 2 and 3 of Pseudomonas solanacearum. Potato Research, 33(2), 287-290. doi: 10.1007/BF02358459

                                                                                                                                                                                    Tan YJ, Duan NX, Liao BS, Xu ZY, He LY, Zheng GR, 1994. Status of groundnut bacterial wilt research in China. Groundnut bacterial wilt in Asia. Proceedings of the third working group meeting 4-5 July 1994, Oil Crops Research Institute, Wuhan, China [edited by Mehan, V. K.; McDonald, D.] Patancheru, India; International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), 107-113

                                                                                                                                                                                    Tan ZhiQiong, Zhang RongYi, Li GuiZhen, Wang Qiong, Lin YunPing, Wen YanTang, 2006. Symptoms of bacterial wilt and identification of the causal organism on Anthurium andraeanum. Acta Phytopathologica Sinica, 36(5):392-396

                                                                                                                                                                                    Tebaldi ND, Leite LN, Marque JMde, Furlanetto MCA, Mota LCBM, 2014. Occurrence of Ralstonia solanacearum on olive tree in Brazil. Summa Phytopathologica, 40(2):185. http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-54052014000200014&lng=en&nrm=iso&tlng=en

                                                                                                                                                                                    Thammakijjawat P, Thaveechai N, Paradhonuwat A, Wannakairoj S, Suthirawut S, 1999. Bacterial rhizome rot of patumma and detection of seed-borne rhizome. The 37th Kasetsart University Annual Conference, 3-5 February, 1999., 295-302; 11 ref

                                                                                                                                                                                    Thano, P., Akarapisan, A., 2018. Phylotype and sequevar of Ralstonia solanacearum which causes bacterial wilt in Curcuma alismatifolia Gagnep. Letters in Applied Microbiology, 66(5), 384-393. doi: 10.1111/lam.12857

                                                                                                                                                                                    Thera AT, Jacobsen BJ, Neher OT, 2010. Bacterial wilt of solanaceae caused by Ralstonia solanacearum race 1 biovar 3 in Mali. Plant Disease, 94(3):372. http://apsjournals.apsnet.org/loi/pdis

                                                                                                                                                                                    Thwaite R, Mansfield J, Eden-Green S, Seal S, 1999. RAPD and repPCR-based fingerprinting of vascular bacterial pathogens of Musa spp. Plant Pathology, 48:121-128

                                                                                                                                                                                    Timms-Wilson TM, Bryant K, Bailey MJ, 2001. Strain characterization and 16S-23S probe development for differentiating geographically dispersed isolates of the phytopathogen Ralstonia solanacearum. Environmental Microbiology, 3(12):785-797

                                                                                                                                                                                    Titatarn V, 1985. Bacterial wilt in Thailand. Bacterial wilt disease in Asia and the South Pacific Canberra, ACT, Australia; Australian Centre for International Agricultural Research, 65-67

                                                                                                                                                                                    Tomlinson DL, Elphinstone JG, Soliman MY, Hanafy MS, Shoala TM, El-Fatah HA, Agag SH, Kamal M, El-Aliem MMA, Fawzi FG, Stead DE, Janse JD, 2009. Recovery of Ralstonia solanacearum from canal water in traditional potato-growing areas of Egypt but not from designated Pest-Free Areas (PFAs). European Journal of Plant Pathology, 125(4):589-601. http://springerlink.metapress.com/link.asp?id=100265

                                                                                                                                                                                    Toukam GMS, Cellier G, Wicker E, Guilbaud C, Kahane R, Allen C, Prior P, 2009. Broad diversity of Ralstonia solanacearum strains in Cameroon. Plant Disease, 93(11):1123-1130. http://apsjournals.apsnet.org/loi/pdis

                                                                                                                                                                                    Toukam, G. M. S., Cellier, G., Wicker, E., Guilbaud, C., Kahane, R., Allen, C., Prior, P., 2009. Broad diversity of Ralstonia solanacearum strains in Cameroon. Plant Disease, 93(11), 1123-1130. http://apsjournals.apsnet.org/loi/pdis doi: 10.1094/PDIS-93-11-1123

                                                                                                                                                                                    Tsang MMC, Shintaku M, 1998. Hot air treatment for control of bacterial wilt in ginger root. Applied Engineering in Agriculture, 14(2):159-163; 20 ref

                                                                                                                                                                                    Tu QB, Wang PY, Sheng S, Xu Y, Wang JZ, You S, Zhu AH, Wang J, Wu FA, 2020. Microencapsulation and Antimicrobial Activity of Plant Essential Oil Against Ralstonia solanacearum. In: Waste Biomass Valor . https://doi.org/10.1007/s12649-020-00987-6

                                                                                                                                                                                    Tuan Minh Tran, Jacobs, J. M., Huerta, A., Milling, A., Weibel, J., Allen, C., 2016. Sensitive, secure detection of race 3 biovar 2 and native U.S. strains of Ralstonia solanacearum. Plant Disease, 100(3), 630-639. doi: 10.1094/PDIS-12-14-1327-RE

                                                                                                                                                                                    Tuin WR van der, Nahumury ET, Spit BE, Janse JD, 1996. Pseudomonas (Ralstonia)solanacearum race 1, biovar 4 in Curcuma longa. Verslagen en Meded. Plantenziektenk. Dienst 186, 1997, Annual Report 1996:17

                                                                                                                                                                                    Umesha S, Chandan S, Swamy LN, 2012. Colony PCR-single strand confirmation polymorphism for the detection of Ralstonia solanacearum in tomato. International Journal of Integrative Biology, 13(1):45-51. http://www.classicrus.com/cgi-bin/.cgi/plConte.cgi?OO/kFrm/JVista/khD_JVista+LG302471188818057.lg+AB+B3Conte+IJIB+2012+13+1+3210

                                                                                                                                                                                    Uwamahoro, F., Berlin, A., Bucagu, C., Bylund, H., Yuen, J., 2018. Potato bacterial wilt in Rwanda: occurrence, risk factors, farmers' knowledge and attitudes. Food Security, 10(5), 1221-1235. doi: 10.1007/s12571-018-0834-z

                                                                                                                                                                                    Verma RK, Shekhawat GS, 1991. Effect of crop rotation and chemical soil treatment on bacterial wilt of potato. Indian Phytopathology, 44(1):5-8

                                                                                                                                                                                    Verma SK, Gupta NN, Phogat KPS, 1997. Studies on the interaction between root-knot nematodes, Meloidogyne spp.; fungi, Fusarium oxysporum and F. solani and bacterium, Pseudomonas solanacearum [Ralstonia solanacearum] on brinjal, Solanum melongena L. under valley condition of Garhwal hills. Progressive Horticulture, 29(3/4):188-193; 12 ref

                                                                                                                                                                                    Vijayakumar S, Thyagaraj NE, Vishwanathappa KR, Devaiah CP, 1985. Effect of type of planting material on yield and wilt incidence in potato. Plant Pathology Newsletter, 3:13-14

                                                                                                                                                                                    Volcani Z, Palti J, 1960. Pseudomonas solanacearum in Israel. Plant Disease Reporter, 44:448-449

                                                                                                                                                                                    Wei Zhong, Huang JianFeng, Tan ShiYong, Mei XinLan, Shen QiRong, Xu YangChun, 2013. The congeneric strain Ralstonia pickettii QL-A6 of Ralstonia solanacearum as an effective biocontrol agent for bacterial wilt of tomato. Biological Control, 65(2), 278-285. doi: 10.1016/j.biocontrol.2012.12.010

                                                                                                                                                                                    Weingartner DP, Shumaker JR, 1984. Bacterial wilt and tuber brown rot as a potential threat to potato production in Northeast Florida. Proceedings of the Florida State Horticultural Society, 97:198-200

                                                                                                                                                                                    Wenneker M, Beuningen ARvan, Nieuwenhuijze AEMvan, Janse JD, 1998. Survival of brown rot and disinfection of surface water. The survival of the brown rot bacteria (Pseudomonas solanacearum) in several substrates and the efficiency of several methods for the disinfection of surface water. Gewasbescherming, 29(1):7-11; 10 ref

                                                                                                                                                                                    Wenneker M, Verdel MSW, Groeneveld RMW, Kempenaar C, Beuningen ARvan, Janse JD, 1999. Ralstonia (Pseudomonas) solanacearum race 3 (biovar 2) in surface water and natural weed hosts: First report on stinging nettle (Urtica dioica). European Journal of Plant Pathology, 105(3):307-315; 25 ref

                                                                                                                                                                                    Wicker E, Grassart L, Coranson-Beaudu R, Mian D, Guilbaud C, Fegan M, Prior P, 2007. Ralstonia solanacearum strains from Martinique (French West Indies) exhibiting a new pathogenic potential. Applied and Environmental Microbiology, 73(21):6790-6801. http://aem.asm.org

                                                                                                                                                                                    Wicker E, Grassart L, Coranson-Beaudu R, Mian D, Prior P, 2009. Epidemiological evidence for the emergence of a new pathogenic variant of Ralstonia solanacearum in Martinique (French West Indies). Plant Pathology, 58(5):853-861. http://www3.interscience.wiley.com/journal/122443427/abstract

                                                                                                                                                                                    Wicker E, Lefeuvre P, Cambiaire JCde, Lemaire C, Poussier S, Prior P, 2011. Contrasting recombination patterns and demographic histories of the plant pathogen Ralstonia solanacearum inferred from MLSA. The ISME Journal, 17 November 2011(doi:10.1038/ismej.2011.160)

                                                                                                                                                                                    Wicker, E., Lefeuvre, P., Cambiaire, J. C. de, Lemaire, C., Poussier, S., Prior, P., 2012. Contrasting recombination patterns and demographic histories of the plant pathogen Ralstonia solanacearum inferred from MLSA. ISME Journal, 6(5), 961-974. doi: 10.1038/ismej.2011.160

                                                                                                                                                                                    Wolf JMVan der, Bonants PJM, Smith JJ, Hagenaar M, Nijhuis E, Beckhoven JRCMvan, Saddler GS, Trigalet A, Feuillade R, 1998.

                                                                                                                                                                                    Wu YF, Cheng AS, Lin CH, Chen CY, 2013. First report of bacterial wilt caused by Ralstonia solanacearum on Roselle in Taiwan. Plant Disease, 97(10):1375. http://apsjournals.apsnet.org/loi/pdis

                                                                                                                                                                                    Wullings BA, Beuningen ARvan, Janse JD, Akkermans ADL, 1998. Detection of Ralstonia solanacearum, which causes brown rot of potato, by fluorescent in situ hybridization with 23S rRNA-targeted probes. Applied and Environmental Microbiology, 64(11):4546-4554; 44 ref

                                                                                                                                                                                    Xiao LZ, Zhu ZD, He KL, Zhou MN, Lin GF, 1983. Observations of the infected portion of mulberry bacterial wilt by scanning electron microscopy. Science of Sericulture (Canye Kexue), 9:58-59

                                                                                                                                                                                    Xu J, Pan ZC, Prior P, Xu JS, Zhang Z, Zhang H, Zhang LQ, He LY, Feng J, 2009. Genetic diversity of Ralstonia solanacearum strains from China. European Journal of Plant Pathology, 125(4):641-653. http://springerlink.metapress.com/link.asp?id=100265

                                                                                                                                                                                    Xue QingYun, Yin YanNi, Yang Wei, Heuer H, Prior P, Guo JianHua, Smalla K, 2011. Genetic diversity of Ralstonia solanacearum strains from China assessed by PCR-based fingerprints to unravel host plant- and site-dependent distribution patterns. FEMS Microbiology Ecology, 75(3):507-519. http://onlinelibrary.wiley.com/journal/10.1111/(ISSN)1574-6941

                                                                                                                                                                                    Yabuuchi E, Kosako Y, Oyaizu H, Yano I, Hotta H, Hashimoto Y, Ezaki T, Arakawa M, 1992. Proposal of Burkholderia gen. nov. and transfer of seven species of the genus Pseudomonas homology group II to the new genus, with the type species Burkholderia cepacia (Palleroni and Holmes 1981) comb. nov. Microbiology and Immunology, 36(12):1251-1275; 30 ref

                                                                                                                                                                                    Yabuuchi E, Kosako Y, Yano I, Hotta H, Nishiuchi Y, 1995. Transfer of two Burkholderia and an Alcaligenes species to Ralstonia gen.nov.: Proposal of Ralstonia pickettii (Ralston, Palleroni and Douderoff 1973) comb.nov., Ralstonia solanacearum (Smith 1896) comb. nov. and Ralstonia eutropha (Davis 1969) comb. nov. Microbiology and Immunology, 39:897-904

                                                                                                                                                                                    Yadessa, G. B., Bruggen, A. H. C. van, Ocho, F. L., 2010. Effects of different soil amendments on bacterial wilt caused by Ralstonia solanacearum and on the yield of tomato. Journal of Plant Pathology, 92(2), 439-450. http://www.sipav.org/main/jpp/

                                                                                                                                                                                    Yeh WL, 1990. A review of bacterial wilt on groundnut in Guangdong Province, Peoples' Republic of China. ACIAR Proceedings Series, No. 31:48-51

                                                                                                                                                                                    Yen JH, Chen DY, Hseu SH, Lin CY, Tsay TT, 1997. The effect of plant-parasitic nematodes on severity of bacterial wilt in solanaceous plants. Plant Pathology Bulletin, 6(4):141-153; 44 ref

                                                                                                                                                                                    Yik CP, 1988. Plant disease research and service, Primary Production Department. Singapore Journal of Primary Industries, 16(2, Supplement):30-37

                                                                                                                                                                                    Yik CP, Ong AK, Ho R, 1994. Characterization of Pseudomonas solanacearum strains from Singapore. Singapore Journal of Primary Industries, 22(2):57-62

                                                                                                                                                                                    Yin XianGui, Li JianHua, Pan GuangHui, Zhang Yun, Yang QiFeng, 2006. Breeding of promising tomato genotypes and hybrids against bacterial wilt. Southwest China Journal of Agricultural Sciences, 19(1):103-107

                                                                                                                                                                                    Young JM, Allen C, Coutinho T, Denny T, Elphinstone J, Fegan M, Gillings M, Gottwald TR, Graham JH, Iacobellis NS, Janse JD, Jacques M-A, Lopez MM, Morris CE, Parkinson N, Prior P, Pruvost O, Rodrigues Neto J, Scortichini M, Takikawa Y, Upper CD, 2008. Letter to the Editor: Plant-Pathogenic Bacteria as Biological Weapons - Real Threats? Phytopathology, 98:1060-1065

                                                                                                                                                                                    Yuliar, Nion, Y. A., Toyota, K., 2015. Recent trends in control methods for bacterial wilt diseases caused by Ralstonia solanacearum. Microbes and Environments, 30(1), 1-11. doi: 10.1264/jsme2.ME14144

                                                                                                                                                                                    Zachos DG, 1957. The brown rot of potatoes in Greece. Annales de l'Institut Phytopathologique Benaki, New Series 1, 115-117

                                                                                                                                                                                    Zehr EI, 1969. Studies of the distribution and economic importance of Pseudomonas solanacearum in certain crops in the Philippines. Philippine Agriculturist, 53:218-223

                                                                                                                                                                                    Zeng DF, Tan YJ, Xu ZY, 1994. Survival of Pseudomonas solanacearum in peanut seeds. Bacterial Wilt Newsletter, 10:8-9

                                                                                                                                                                                    Zhang YX, Hua JY, He LY, 1993. Effect of infected groundnut seeds on transmission of Pseudomonas solanacearum. Bacterial Wilt Newsletter, 9:9-10

                                                                                                                                                                                    Distribution References

                                                                                                                                                                                    Adebayo O S, Nwanguma E I, 2011. Incidence of Phytophthora blight and bacterial wilt in dry season pepper production in Katsina, Nigeria. Acta Horticulturae. 175-180. http://www.actahort.org/books/917/917_22.htm

                                                                                                                                                                                    Alfenas A C, Mafia R G, Sartório R C, Binoti D H B, Silva R R, Lau D, Vanetti C A, 2006. Ralstonia solanacearum on eucalyptus clonal nurseries in Brazil. (Ralstonia solanacearum em viveiros clonais de eucalipto no Brasil.). Fitopatologia Brasileira. 31 (4), 357-366. http://www.scielo.br/pdf/fb/v31n4/05.pdf DOI:10.1590/S0100-41582006000400005

                                                                                                                                                                                    Andrade F W R de, Amorim E P da R, Eloy A P, Rufino M J, 2009. Occurence of banana diseases in the state of Alagoas. (Ocorrência de doenças em bananeiras no estado de Alagoas.). Summa Phytopathologica. 35 (4), 305-309. http://www.scielo.br/pdf/sp/v35n4/a08v35n4.pdf DOI:10.1590/S0100-54052009000400008

                                                                                                                                                                                    Arriel D A A, Fonseca N R, Guimarães L M S, Hermenegildo P S, Mafia R G, Borges Júnior N, Souza H P de, Alfenas A C, 2014. Wilt and die-back of Eucalyptus spp. caused by Erwinia psidii in Brazil. Forest Pathology. 44 (4), 255-265. DOI:10.1111/efp.12087

                                                                                                                                                                                    Baideng E L, Lengkong H J, Frans T M, Koneri R, Pontororing H, 2019. Types of insects associated with potato plants (Solanum tuberosum L.) and the incidence of the disease in Modoinding, North Sulawesi, Indonesia. Scientific Papers Series - Management, Economic Engineering in Agriculture and Rural Development. 19 (4), 25-28. http://managementjournal.usamv.ro/pdf/vol.19_4/Art3.pdf

                                                                                                                                                                                    Begum N, Haque M I, Mukhtar T, Naqvi S M, Wang J F, 2012. Status of bacterial wilt caused by Ralstonia solanacearum in Pakistan. Pakistan Journal of Phytopathology. 24 (1), 11-20.

                                                                                                                                                                                    Bekele B, Abate E, Asefa A, Dickinson M, 2011. Incidence of potato viruses and bacterial wilt disease in the west Amhara sub-region of Ethiopia. Journal of Plant Pathology. 93 (1), 149-157. http://sipav.org/main/jpp/index.php/jpp/article/view/285/151

                                                                                                                                                                                    CABI, 2020. CABI Distribution Database: Status inferred from regional distribution. Wallingford, UK: CABI

                                                                                                                                                                                    CABI, Undated. Compendium record. Wallingford, UK: CABI

                                                                                                                                                                                    CABI, Undated a. CABI Compendium: Status as determined by CABI editor. Wallingford, UK: CABI

                                                                                                                                                                                    Caruso P, Palomo J L, Bertolini E, Álvarez B, López M M, Biosca E G, 2005. Seasonal variation of Ralstonia solanacearum biovar 2 populations in a Spanish river: recovery of stressed cells at low temperatures. Applied and Environmental Microbiology. 71 (1), 140-148. DOI:10.1128/AEM.71.1.140-148.2005

                                                                                                                                                                                    Chandrashekara K N, Prasannakumar M K, 2010. New host plants for Ralstonia solanacearum from India. Plant Pathology. 59 (6), 1164. DOI:10.1111/j.1365-3059.2010.02358.x

                                                                                                                                                                                    Chandrashekara K N, Prasannakumar M K, Deepa M, Vani A, 2011. Coleus, a new host for Ralstonia solanacearum race 1 biovar 3 in India. Journal of Plant Pathology. 93 (1), 233-235. http://sipav.org/main/jpp/index.php/jpp/article/view/298/164

                                                                                                                                                                                    Chandrashekara K N, Prasannakumar M K, Manthirachalam Deepa, Akella Vani, Khan A N A, 2012. Prevalence of races and biotypes of Ralstonia solanacearum in India. Journal of Plant Protection Research. 52 (1), 53-58. DOI:10.2478/v10045-012-0009-4

                                                                                                                                                                                    Cruz L, Eloy M, Quirino F, Carrinho H, 2008. Ralstonia solanacearum biovar 1 associated with a new outbreak of potato brown rot in Portugal. Phytopathologia Mediterranea. 47 (2), 87-91. http://epress.unifi.it/riviste

                                                                                                                                                                                    Danesh D, Bahar M, 1984. Occurrence of bacterial wilt of potato in Iran. In: Proceedings of the Ninth Triennial Conference of the European Association for Potato Research, Switzerland: Interlaken [Ninth Triennial Conference of the European Association for Potato Research, Switzerland: Interlaken], Interlaken, Switzerland: 407-408.

                                                                                                                                                                                    Duan Y P, Sun X, Zhou L J, Gabriel D W, Benyon L S, Gottwald T, 2009. Bacterial brown leaf spot of citrus, a new disease caused by Burkholderia andropogonis. Plant Disease. 93 (6), 607-614. http://apsjournals.apsnet.org/loi/pdis DOI:10.1094/PDIS-93-6-0607

                                                                                                                                                                                    Dubey S C, 2005. Integrated management of bacterial wilt of tomato. Plant Disease Research (Ludhiana). 20 (1), 52-54.

                                                                                                                                                                                    EPPO, 2014. EPPO Global database (available online). Paris, France: EPPO. https://gd.eppo.int/

                                                                                                                                                                                    EPPO, 2020. EPPO Global database. In: EPPO Global database, Paris, France: EPPO. https://gd.eppo.int/

                                                                                                                                                                                    Fiori M, Gallelli A, Fiori V, Ligios V, Loreti S, 2009. A new outbreak of Ralstonia solanacearum on tomato in Sardinia. Journal of Plant Pathology. 91 (4, Supplement), S4.103. http://www.sipav.org/main/jpp/

                                                                                                                                                                                    Freire F das C O, Mosca J L, 2009. Diseases of flowers and ornamental plants in Ceará State, Brazil. (Patógenos associados a doenças de plantas ornamentals no Estado do Ceará.). Revista Brasileira de Horticultura Ornamental. 15 (1), 83-89. http://www.sbfpo.com.br

                                                                                                                                                                                    Gopalakrishnan C, Artal R B, Anuradha Sane, 2016. Occurrence of Ralstonia solanacearum causing bacterial wilt on Bird of Paradise, Strelitzia reginae in India. Indian Phytopathology. 69 (4s), 44-46. http://epubs.icar.org.in/ejournal/index.php/IPPJ/article/view/71226/30113

                                                                                                                                                                                    Hong J C, Momol M T, Jones J B, Ji P S, Olson S M, Allen C, Perez A, Prakash P, Guven K, 2008. Detection of Ralstonia solanacearum in irrigation ponds and aquatic weeds associated with the ponds in North Florida. Plant Disease. 92 (12), 1674-1682. HTTP://www.apsnet.org DOI:10.1094/PDIS-92-12-1674

                                                                                                                                                                                    IPPC, 2006. Occurrence of the moko disease in Jamaica. In: IPPC Official Pest Report, Rome, Italy: FAO. https://www.ippc.int/IPP/En/default.jsp

                                                                                                                                                                                    IPPC, 2007. IPPC Official Pest Report., Rome, Italy: FAO. https://www.ippc.int/en/

                                                                                                                                                                                    IPPC, 2010. Potato brown rot outbreak. In: IPPC Official Pest Report, Rome, Italy: FAO. https://www.ippc.int/

                                                                                                                                                                                    IPPC, 2013. Ralstonia solanacearum is absent in Denmark. In: IPPC Official Pest Report, No. DNK-08/2, Rome, Italy: FAO. https://www.ippc.int/

                                                                                                                                                                                    IPPC, 2016. Information on Pest Status in the Republic of Lithuania in 2015. In: IPPC Official Pest Report, No. LTU-01/2, Rome, Italy: FAO. https://www.ippc.int/

                                                                                                                                                                                    IPPC, 2020. Ralstonia solanacearum race 3 biovar 2: Detection in a United States Greenhouse. In: IPPC Official Pest Report, Rome, Italy: FAO. https://www.ippc.int/

                                                                                                                                                                                    Izadiyan M, Taghavi S M, 2011. Diversity of Iranian isolates of Ralstonia solanacearum. Phytopathologia Mediterranea. 50 (2), 236-244. http://www.fupress.com/pm/

                                                                                                                                                                                    Jeong YeonHwa, Kim JinWoo, Kang YongSung, Lee SeungDon, Hwang IngYu, 2007. Genetic diversity and distribution of Korean isolates of Ralstonia solanacearum. Plant Disease. 91 (10), 1277-1287. DOI:10.1094/PDIS-91-10-1277

                                                                                                                                                                                    Ji P S, Allen C, Sanchez-Perez A, Yao J, Elphinstone J G, Jones J B, Momol M T, 2007. New diversity of Ralstonia solanacearum strains associated with vegetable and ornamental crops in Florida. Plant Disease. 91 (2), 195-203. HTTP://www.apsnet.org DOI:10.1094/PDIS-91-2-0195

                                                                                                                                                                                    Jiang Y, Li B, Liu P, Liao F, Weng Q, Chen Q, 2016. First report of bacterial wilt caused by Ralstonia solanacearum on fig trees in China. Forest Pathology. 46 (3), 256-258. DOI:10.1111/efp.12267

                                                                                                                                                                                    Khoodoo M H R, Ganoo E S, Saumtally S, 2007. First report of Ralstonia solanacearum race 3 biovar 2A infecting potato and weeds in Mauritius. Plant Disease. 91 (9), 1200. DOI:10.1094/PDIS-91-9-1200B

                                                                                                                                                                                    Kim S H, Olson T N, Schaad N W, Moorman G W, 2003. Ralstonia solanacearum race 3, biovar 2, the causal agent of brown rot of potato, identified in geraniums in Pennsylvania, Delaware, and Connecticut. Plant Disease. 87 (4), 450. DOI:10.1094/PDIS.2003.87.4.450C

                                                                                                                                                                                    Klass T L, Hayes M M, Seng K H, An C, Rotondo F, Shoaf W W, Ong S, Tho K E, Allen C, Miller S A, Jacobs J M, 2020. First report of bacterial wilt of tomato caused by Ralstonia pseudosolanacearum (Ralstonia solanacearum phylotype I) in Cambodia. Plant Disease. 104 (3), 969-969. DOI:10.1094/PDIS-09-19-1823-PDN

                                                                                                                                                                                    Li Peng, Zhou HengCang, Wu XingXing, Wang ZhiYuan, Ho H H, Wu YiXin, Mao ZiChao, He YueQiu, 2012. First record and description of Ralstonia solanacearum wilt in patchouli from Yunnan Province, China. Indian Phytopathology. 65 (2), 208-210. http://epubs.icar.org.in/ejournal/index.php/IPPJ

                                                                                                                                                                                    Li Q Q, Feng J X, Tang J L, Lin W, Duan C J, Ye Y F, Luo K, 2005. Siraitia grosvenorii (Luo Han Guo; Cucurbitaceae) is a new host of Ralstonia solanacearum in China. Plant Pathology. 54 (6), 811. DOI:10.1111/j.1365-3059.2005.01227.x

                                                                                                                                                                                    Lin C H, Chuang M H, Wang J F, 2015. First report of bacterial wilt caused by Ralstonia solanacearum on chard in Taiwan. Plant Disease. 99 (2), 282. http://apsjournals.apsnet.org/loi/pdis DOI:10.1094/PDIS-07-14-0715-PDN

                                                                                                                                                                                    Liu Q, Li Y, Chen J, 2011. First report of bacterial wilt caused by Ralstonia solanacearum on Mesona chinensis in China. Plant Disease. 95 (2), 222. http://apsjournals.apsnet.org/loi/pdis

                                                                                                                                                                                    Long LiQin, Sang WeiJun, Diao ChaoQiang, Yang MaoFa, Luo ZhenYou, Rao YinYong, Chen SenYu, 2008. A preliminary report on tobacco root and stem diseases in Hezhang County, Guizhou. Guizhou Agricultural Sciences. 103-105.

                                                                                                                                                                                    Loreti S, Fiori M, Simone D de, Falchi G, Gallelli A, Schiaffino A, Ena S, 2008. Bacterial wilt, caused by Ralstonia solanacearum, on tomato in Italy. Plant Pathology. 57 (2), 368. http://www.blackwell-synergy.com/doi/full/10.1111/j.1365-3059.2007.01729.x DOI:10.1111/j.1365-3059.2007.01729.x

                                                                                                                                                                                    McCLEAN A P D, 1930. The bacterial wilt disease of Peanuts (Arachis hypogaea L.). Science Bulletin. Department of Agriculture and Forestry, Union of South Africa. 14 pp.

                                                                                                                                                                                    Mepharishvili G, Sikharulidze Z, Thwaites R, Tsetskhladze T, Dumbadze R, Gabaidze M, Muradashvili M, 2012. First confirmed report of bacterial wilt of tomato in Georgia caused by Ralstonia solanacearum. New Disease Reports. 16. http://www.ndrs.org.uk/article.php?id=025016 DOI:10.5197/j.2044-0588.2012.025.016

                                                                                                                                                                                    Milijašević-Marčić S, Todorović B, Potočnik I, Rekanović E, Stepanović M, Mitrović J, Duduk B, 2013. Ralstonia solanacearum - a new threat to potato production in Serbia. Pesticidi i Fitomedicina. 28 (4), 229-237. http://www.pesting.org.rs/ DOI:10.2298/PIF1304229M

                                                                                                                                                                                    Mondal B, Sunita Mahapatra, Khatua D C, 2012. Records of some new diseases of horticultural plants of West Bengal. Journal of Interacademicia. 16 (1), 36-43.

                                                                                                                                                                                    Muradashvili M, Meparishvili G, Sikharulidze Z, Meparishvili S, 2014. First report of potato brown rot caused by Ralstonia solanacearum in Georgia. Journal of Plant Pathology. 96 (4), S4.113-S4.131.

                                                                                                                                                                                    Norman D J, Bocsanczy A M, Harmon P, Harmon C L, Khan A, 2018. First report of bacterial wilt disease caused by Ralstonia solanacearum on blueberries (Vaccinium corymbosum) in Florida. Plant Disease. 102 (2), 438. DOI:10.1094/PDIS-06-17-0889-PDN

                                                                                                                                                                                    Nouri S, Bahar M, Fegan M, 2009. Diversity of Ralstonia solanacearum causing potato bacterial wilt in Iran and the first record of phylotype II/biovar 2T strains outside South America. Plant Pathology. 58 (2), 243-249. DOI:10.1111/j.1365-3059.2008.01944.x

                                                                                                                                                                                    Opina N L, Miller S A, 2005. Evaluation of immunoassays for detection of Ralstonia solanacearum, causal agent of bacterial wilt of tomato and eggplant in the Philippines. Acta Horticulturae. 353-356. http://www.actahort.org

                                                                                                                                                                                    Perez A S, Mejia L, Fegan M, Allen C, 2008. Diversity and distribution of Ralstonia solanacearum strains in Guatemala and rare occurrence of tomato fruit infection. Plant Pathology. 57 (2), 320-331. http://www.blackwell-synergy.com/doi/full/10.1111/j.1365-3059.2007.01769.x DOI:10.1111/j.1365-3059.2007.01769.x

                                                                                                                                                                                    Pradhanang P M, Momol M T, 2001. Survival of Ralstonia solanacearum in soil under irrigated rice culture and aquatic weeds. Journal of Phytopathology. 149 (11/12), 707-711. DOI:10.1046/j.1439-0434.2001.00700.x

                                                                                                                                                                                    Pradhanang P M, Momol M T, Dankers H, Momol E A, Jones J B, 2002. First report of southern wilt caused by Ralstonia solanacearum on geranium in Florida. Plant Health Progress. 1-2. http://www.plantmanagementnetwork.org/pub/php/brief/geranium

                                                                                                                                                                                    Ramsubhag A, Lawrence D, Cassie D, Fraser R, Umaharan P, Prior P, Wicker E, 2012. Wide genetic diversity of Ralstonia solanacearum strains affecting tomato in Trinidad, West Indies. Plant Pathology. 61 (5), 844-857. http://onlinelibrary.wiley.com/doi/10.1111/j.1365-3059.2011.02572.x/full DOI:10.1111/j.1365-3059.2011.02572.x

                                                                                                                                                                                    Ravelomanantsoa S, Vernière C, Rieux A, Costet L, Chiroleu F, Arribat S, Cellier G, Pruvost O, Poussier S, Robène I, Guérin F, Prior P, 2018. Molecular epidemiology of bacterial wilt in the Madagascar highlands caused by andean (phylotype IIB-1) and African (phylotype III) brown rot strains of the Ralstonia solanacearum species complex. Frontiers in Plant Science. 9 (January), 2258. DOI:10.3389/fpls.2017.02258

                                                                                                                                                                                    Robertson A E, Wechter W P, Denny T P, Fortnum B A, Kluepfel D A, 2004. Relationship between avirulence gene (avrA) diversity in Ralstonia solanacearum and bacterial wilt incidence. Molecular Plant-Microbe Interactions. 17 (12), 1376-1384. DOI:10.1094/MPMI.2004.17.12.1376

                                                                                                                                                                                    Romero G C, Estévez de Jensen C, Palmateer A J, 2013. First report of tomato wilt caused by Ralstonia solanacearum biovar 1 in Puerto Rico. Plant Health Progress. PHP-2013-0418-01-BR. http://www.plantmanagementnetwork.org/php/elements/sum.aspx?id=10624&photo=5938

                                                                                                                                                                                    Romo J P, Osorio J G M, Yepes M S, 2012. Identification of new hosts for Ralstonia solanacearum (Smith) race 2 from Colombia. Revista de Protección Vegetal. 27 (3), 151-161. http://scielo.sld.cu/scielo.php?script=sci_arttext&pid=S1010-27522012000300003&lng=en&nrm=iso&tlng=en

                                                                                                                                                                                    Ruhl G, Twieg E, DeVries R, Levy L, Byrne J, Mollov D, Taylor N, 2011. First report of bacterial wilt in Mandevilla (=Dipladenia) splendens 'Red Riding Hood' in the United States caused by Ralstonia solanacearum biovar 3. Plant Disease. 95 (5), 614-615. DOI:10.1094/PDIS-11-10-0858

                                                                                                                                                                                    Santiago T R, Grabowski C, Mizubuti E S G, 2014. First report of bacterial wilt caused by Ralstonia solanacearum on Eucalyptus sp. in Paraguay. New Disease Reports. 2. http://www.ndrs.org.uk/article.php?id=029002 DOI:10.5197/j.2044-0588.2014.029.002

                                                                                                                                                                                    Sedighian N, Krijger M, Taparia T, Taghavi SM, Wicker E, van der Wolf JM, Osdaghi E, 2020. Genome Resource of Two Potato Strains of Ralstonia solanacearum Biovar 2 (Phylotype IIB/sequevar 1) and Biovar 2T (Phylotype IIB/Sequevar 25) Isolated from lowlands in Iran. Molecular Plant-Microbe Interactions.

                                                                                                                                                                                    Seleim MAA, Abo-Elyousr KAM, Abd-El-Moneem KM, Saead FA, 2014. First Report of Bacterial Wilt Caused by Ralstonia solanacearum Biovar 2 Race 1 on Tomato in Egypt. Plant Pathol J. 30 (3), 299-303.

                                                                                                                                                                                    She X M, He Z F, Luo F F, Li H P, 2013. First report of bacterial Wilt caused by Ralstonia solanacearum on Ageratum conyzoides in China. Plant Disease. 97 (3), 418-419. http://apsjournals.apsnet.org/loi/pdis DOI:10.1094/PDIS-08-12-0780-PDN

                                                                                                                                                                                    Shrestha G, Prajapati S, Mahato B N, 2014. Plant diseases and their management practices in commercial organic and conventional vegetable farms in Kathmandu valley. Nepalese Journal of Agricultural Sciences. 129-141. http://hicast.edu.np/file/file_down/pdf/pdf11/hx1JAeNJAS_2014_12.pdf

                                                                                                                                                                                    Shutt V M, Shin G, Waals J E van der, Goszczynska T, Coutinho T A, 2018. Characterization of Ralstonia strains infecting tomato plants in South Africa. Crop Protection. 56-62. DOI:10.1016/j.cropro.2018.05.013

                                                                                                                                                                                    Sikirou R, Beed F, Ezin V, Gbèhounou G, Miller S A, Wydra K, 2009. First report of bacterial wilt of tomato (Solanum lycopersicum) caused by Ralstonia solanacearum in Benin. Plant Disease. 93 (5), 549. http://apsjournals.apsnet.org/loi/pdis DOI:10.1094/PDIS-93-5-0549B

                                                                                                                                                                                    Sikirou R, Beed F, Ezin V, Hoteigni J, Miller S A, 2017. Distribution, pathological and biochemical characterization of Ralstonia solanacearum in Benin. Annals of Agricultural Science (Cairo). 62 (1), 83-88. DOI:10.1016/j.aoas.2017.05.003

                                                                                                                                                                                    Sikirou R, Zocli B, Paret M L, Deberdt P, Coranson-Beaudu R, Huat J, Assogba-Komlan F, Dossoumou M E E A, Simon S, Wicker E, 2015. First report of bacterial wilt of Gboma (Solanum macrocarpon) caused by Ralstonia solanacearum in Benin. Plant Disease. 99 (11), 1640. http://apsjournals.apsnet.org/loi/pdis DOI:10.1094/PDIS-02-15-0213-PDN

                                                                                                                                                                                    Subedi N, Gilbertson R L, Osei M K, Cornelius E, Miller S A, 2014. First report of bacterial wilt caused by Ralstonia solanacearum in Ghana, West Africa. Plant Disease. 98 (6), 840. http://apsjournals.apsnet.org/loi/pdis DOI:10.1094/PDIS-09-13-0963-PDN

                                                                                                                                                                                    Sumangala K, Lingaraju S, Hegde Y R, Byadagi A S, 2012. Genetic diversity of Ralstonia solanacaerum from major tomato growing areas of Karnataka. International Journal of Plant Protection. 5 (2), 324-328. http://www.hindagrihorticulturalsociety.co.in/ijpp.html

                                                                                                                                                                                    Sunaina V, Tomar D K, 2003. Distribution of bacterial wilt of potato and its races/biovars in Uttaranchal hills. Bionotes. 5 (1), 13-14.

                                                                                                                                                                                    Tahir M I, Muhammad Inam-ul-Haq, Muhammad Ashfaq, Abbasi N A, 2014. Surveillance of Ralstonia solanacearum infecting potato crop in Punjab. Pakistan Journal of Phytopathology. 26 (1), 45-52. http://pjp.pakps.com/index.php/PJP/article/view/89/42

                                                                                                                                                                                    Tan ZhiQiong, Zhang RongYi, Li GuiZhen, Wang Qiong, Lin YunPing, Wen YanTang, 2006. Symptoms of bacterial wilt and identification of the causal organism on Anthurium andraeanum. Acta Phytopathologica Sinica. 36 (5), 392-396.

                                                                                                                                                                                    Tebaldi N D, Leite L N, Marque J M de, Furlanetto M C A, Mota L C B M, 2014. Occurrence of Ralstonia solanacearum on olive tree in Brazil. Summa Phytopathologica. 40 (2), 185. http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-54052014000200014&lng=en&nrm=iso&tlng=en DOI:10.1590/0100-5405/1983

                                                                                                                                                                                    Teng SukKuan, Nor Azwady A A, Muskhazli Mustafa, Rozeita Laboh, Intan Safinar Ismail, Siti Rohani Sulaiman, Azidah 'Ain Azizan, Sujithra Devi, 2016. The occurrence of blood disease of banana in Selangor, Malaysia. International Journal of Agriculture and Biology. 18 (1), 92-97. http://www.fspublishers.org/published_papers/55957_..pdf

                                                                                                                                                                                    Thera A T, Jacobsen B J, Neher O T, 2010. Bacterial wilt of solanaceae caused by Ralstonia solanacearum race 1 biovar 3 in Mali. Plant Disease. 94 (3), 372. http://apsjournals.apsnet.org/loi/pdis DOI:10.1094/PDIS-94-3-0372B

                                                                                                                                                                                    Toukam G M S, Cellier G, Wicker E, Guilbaud C, Kahane R, Allen C, Prior P, 2009. Broad diversity of Ralstonia solanacearum strains in Cameroon. Plant Disease. 93 (11), 1123-1130. http://apsjournals.apsnet.org/loi/pdis DOI:10.1094/PDIS-93-11-1123

                                                                                                                                                                                    Ustun N, Ozakman M, Karahan A, 2008. First report of bacterial wilt caused by Ralstonia solanacearum biovar 2 on tomato in Turkey. Plant Pathology. 57 (4), 773. DOI:10.1111/j.1365-3059.2007.01790.x

                                                                                                                                                                                    Ustun N, Ozakman M, Karahan A, 2008a. Outbreak of Ralstonia solanacearum biovar 2 causing brown rot on potato in the Aegean Region of Turkey. Plant Disease. 92 (6), 973. DOI:10.1094/PDIS-92-6-0973B

                                                                                                                                                                                    Uwamahoro F, Berlin A, Bucagu C, Bylund H, Yuen J, 2018. Potato bacterial wilt in Rwanda: occurrence, risk factors, farmers' knowledge and attitudes. Food Security. 10 (5), 1221-1235. DOI:10.1007/s12571-018-0834-z

                                                                                                                                                                                    Vasconez IN, Besoain XA, Vega-Celedon P, Valenzuela M, Seeger M, 2020. First Report of Bacterial Wilt Caused by Ralstonia solanacearum Phylotype IIB Sequevar 1 affecting tomato in different Regions of Chile. Plant Disease. https://doi.org/10.1094/PDIS-01-20-0181-PDN

                                                                                                                                                                                    Williamson L, Nakaho K, Hudelson B, Allen C, 2002. Ralstonia solanacearum race 3, biovar 2 strains isolated from geranium are pathogenic on potato. Plant Disease. 86 (9), 987-991. DOI:10.1094/PDIS.2002.86.9.987

                                                                                                                                                                                    Wu Y F, Cheng A S, Lin C H, Chen C Y, 2013. First report of bacterial wilt caused by Ralstonia solanacearum on Roselle in Taiwan. Plant Disease. 97 (10), 1375. http://apsjournals.apsnet.org/loi/pdis DOI:10.1094/PDIS-02-13-0186-PDN

                                                                                                                                                                                    Yik C P, 1988. Singapore Journal of Primary Industries. 16 (2, Supplement) 30-37.

                                                                                                                                                                                    Yik C P, Ong A K, Ho R, 1994. Characterization of Pseudomonas solanacearum strains from Singapore. Singapore Journal of Primary Industries. 22 (2), 57-62.

                                                                                                                                                                                    Yin XianGui, Li JianHua, Pan GuangHui, Zhang Yun, Yang QiFeng, 2006. Breeding of promising tomato genotypes and hybrids against bacterial wilt. Southwest China Journal of Agricultural Sciences. 19 (1), 103-107.

                                                                                                                                                                                    Zulperi D, Sijam K, 2014. First report of Ralstonia solanacearum race 2 biovar 1 causing moko disease of banana in Malaysia. Plant Disease. 98 (2), 275. DOI:10.1094/PDIS-03-13-0321-PDN

                                                                                                                                                                                    Contributors

                                                                                                                                                                                    Top of page

                                                                                                                                                                                    06/04/20 Review by:

                                                                                                                                                                                    Ebrahim Osdaghi, Department of Plant Protection, College of Agriculture, Shiraz University, Shiraz 71441-65186, Iran

                                                                                                                                                                                    Distribution Maps

                                                                                                                                                                                    Top of page
                                                                                                                                                                                    You can pan and zoom the map
                                                                                                                                                                                    Save map
                                                                                                                                                                                    Select a dataset
                                                                                                                                                                                    Map Legends
                                                                                                                                                                                    • CABI Summary Records
                                                                                                                                                                                    Map Filters
                                                                                                                                                                                    Extent
                                                                                                                                                                                    Invasive
                                                                                                                                                                                    Origin
                                                                                                                                                                                    Third party data sources: