Invasive Species Compendium

Detailed coverage of invasive species threatening livelihoods and the environment worldwide

Datasheet

Phytophthora alni species complex
(alder Phytophthora)

Toolbox

Datasheet

Phytophthora alni species complex (alder Phytophthora)

Summary

  • Last modified
  • 09 May 2019
  • Datasheet Type(s)
  • Invasive Species
  • Pest
  • Preferred Scientific Name
  • Phytophthora alni species complex
  • Preferred Common Name
  • alder Phytophthora
  • Taxonomic Tree
  • Domain: Eukaryota
  •   Kingdom: Chromista
  •     Phylum: Oomycota
  •       Class: Oomycetes
  •         Order: Peronosporales
  • Summary of Invasiveness
  • The alder Phytophthora species complex of oomycetes encompasses the hybrid P. ×alni and its two parental species, P. uniformis and P. ×multiformis (

Don't need the entire report?

Generate a print friendly version containing only the sections you need.

Generate report

Pictures

Top of page
PictureTitleCaptionCopyright
Phytophthora alni species complex (phytophthora disease of alders); field symptoms.  Mature, riparian common alder (Alnus glutinosa) stand with high impact of Phytophthora root and collar rot. Germany.
TitleField symptoms
CaptionPhytophthora alni species complex (phytophthora disease of alders); field symptoms. Mature, riparian common alder (Alnus glutinosa) stand with high impact of Phytophthora root and collar rot. Germany.
Copyright©Thomas Jung/Bugwood.org - CC BY-NC 3.0 US
Phytophthora alni species complex (phytophthora disease of alders); field symptoms.  Mature, riparian common alder (Alnus glutinosa) stand with high impact of Phytophthora root and collar rot. Germany.
Field symptomsPhytophthora alni species complex (phytophthora disease of alders); field symptoms. Mature, riparian common alder (Alnus glutinosa) stand with high impact of Phytophthora root and collar rot. Germany.©Thomas Jung/Bugwood.org - CC BY-NC 3.0 US
Phytophthora alni species complex (phytophthora disease of alders); field symptoms. Mature common alder (Alnus glutinosa), with collar rot caused by P. alni showing sparse, chlorotic and small-sized foliage. Germany.
TitleField symptoms
CaptionPhytophthora alni species complex (phytophthora disease of alders); field symptoms. Mature common alder (Alnus glutinosa), with collar rot caused by P. alni showing sparse, chlorotic and small-sized foliage. Germany.
Copyright©Thomas Jung/Bugwood.org - CC BY-NC 3.0 US
Phytophthora alni species complex (phytophthora disease of alders); field symptoms. Mature common alder (Alnus glutinosa), with collar rot caused by P. alni showing sparse, chlorotic and small-sized foliage. Germany.
Field symptomsPhytophthora alni species complex (phytophthora disease of alders); field symptoms. Mature common alder (Alnus glutinosa), with collar rot caused by P. alni showing sparse, chlorotic and small-sized foliage. Germany.©Thomas Jung/Bugwood.org - CC BY-NC 3.0 US
Phytophthora alni species complex (phytophthora disease of alders); field symptoms.  Common alder (A. glutinosa) in a non-flooded forest plantation, with root and collar rot caused by P. alni. Germany.
TitleField symptoms
CaptionPhytophthora alni species complex (phytophthora disease of alders); field symptoms. Common alder (A. glutinosa) in a non-flooded forest plantation, with root and collar rot caused by P. alni. Germany.
Copyright©Thomas Jung/Bugwood.org - CC BY-NC 3.0 US
Phytophthora alni species complex (phytophthora disease of alders); field symptoms.  Common alder (A. glutinosa) in a non-flooded forest plantation, with root and collar rot caused by P. alni. Germany.
Field symptomsPhytophthora alni species complex (phytophthora disease of alders); field symptoms. Common alder (A. glutinosa) in a non-flooded forest plantation, with root and collar rot caused by P. alni. Germany.©Thomas Jung/Bugwood.org - CC BY-NC 3.0 US
Phytophthora alni species complex (phytophthora disease of alders); field symptoms.  Mature common alder (A. glutinosa) with collar rot by P. alni (note tarry spots at the outer bark) growing in a forest stand; introduction of the pathogen via alder plantation in the neighbourhood established with infested planting stock. Germany.
TitleField symptoms
CaptionPhytophthora alni species complex (phytophthora disease of alders); field symptoms. Mature common alder (A. glutinosa) with collar rot by P. alni (note tarry spots at the outer bark) growing in a forest stand; introduction of the pathogen via alder plantation in the neighbourhood established with infested planting stock. Germany.
Copyright©Thomas Jung/Bugwood.org - CC BY-NC 3.0 US
Phytophthora alni species complex (phytophthora disease of alders); field symptoms.  Mature common alder (A. glutinosa) with collar rot by P. alni (note tarry spots at the outer bark) growing in a forest stand; introduction of the pathogen via alder plantation in the neighbourhood established with infested planting stock. Germany.
Field symptomsPhytophthora alni species complex (phytophthora disease of alders); field symptoms. Mature common alder (A. glutinosa) with collar rot by P. alni (note tarry spots at the outer bark) growing in a forest stand; introduction of the pathogen via alder plantation in the neighbourhood established with infested planting stock. Germany.©Thomas Jung/Bugwood.org - CC BY-NC 3.0 US
Phytophthora alni species complex (phytophthora disease of alders); field symptoms.  Grey alder (Alnus  incana), with collar rot caused by P. alni; note the typical tarry spots at the outer bark and the tongue-shaped orange-brown necrosis of the inner bark. Germany.
TitleField symptoms
CaptionPhytophthora alni species complex (phytophthora disease of alders); field symptoms. Grey alder (Alnus incana), with collar rot caused by P. alni; note the typical tarry spots at the outer bark and the tongue-shaped orange-brown necrosis of the inner bark. Germany.
Copyright©Thomas Jung/Bugwood.org - CC BY-NC 3.0 US
Phytophthora alni species complex (phytophthora disease of alders); field symptoms.  Grey alder (Alnus  incana), with collar rot caused by P. alni; note the typical tarry spots at the outer bark and the tongue-shaped orange-brown necrosis of the inner bark. Germany.
Field symptomsPhytophthora alni species complex (phytophthora disease of alders); field symptoms. Grey alder (Alnus incana), with collar rot caused by P. alni; note the typical tarry spots at the outer bark and the tongue-shaped orange-brown necrosis of the inner bark. Germany.©Thomas Jung/Bugwood.org - CC BY-NC 3.0 US
Phytophthora alni species complex (phytophthora disease of alders); field symptoms. Slovakia
TitleField symptoms
CaptionPhytophthora alni species complex (phytophthora disease of alders); field symptoms. Slovakia
Copyright©Andrej Kunca/National Forest Centre, Slovakia/Bugwood.org - CC BY-NC 3.0 US
Phytophthora alni species complex (phytophthora disease of alders); field symptoms. Slovakia
Field symptomsPhytophthora alni species complex (phytophthora disease of alders); field symptoms. Slovakia©Andrej Kunca/National Forest Centre, Slovakia/Bugwood.org - CC BY-NC 3.0 US

Identity

Top of page

Preferred Scientific Name

  • Phytophthora alni species complex

Preferred Common Name

  • alder Phytophthora

Other Scientific Names

  • Phytophthora ×alni (Brasier & S.A. Kirk, 2004) Husson, Ioos & Marçais, 2015, nothosp. nov.
  • Phytophthora ×multiformis (Brasier & S.A. Kirk, 2004) Husson, Ioos & Frey, 2015, nothosp. nov.
  • Phytophthora alni
  • Phytophthora alni subspecies alni Brasier & S.A. Kirk, 2004
  • Phytophthora alni subspecies multiformis Brasier & S.A. Kirk, 2004
  • Phytophthora alni subspecies uniformis Brasier & S.A. Kirk, 2004
  • Phytophthora uniformis (Brasier & S.A. Kirk, 2004) Husson, Ioos & Aguayo, 2015, comb. nov.

International Common Names

  • English: Phytophthora disease of alder; root disease of alder

Local Common Names

  • France: Phytophthora de l’aulne

EPPO code

  • PHYTAL (Phytophthora alni)

Summary of Invasiveness

Top of page

The alder Phytophthora species complex of oomycetes encompasses the hybrid P. ×alni and its two parental species, P. uniformis and P. ×multiformis (Brasier et al., 1999; Husson et al., 2015). It emerged in the early 1990s and is associated with severe decline of alder trees on river banks of Europe. The main pathogen involved, P. ×alni, was previously unreported. Its pattern of occurrence suggests an invasive species, but one that arose from several hybridization events in different places rather than spreading from a central origin. The population structure of P. uniformis, one of the parental species, suggests that it is introduced in Europe and native in North America (Aguayo et al., 2013); the origin of the second parent, P. ×multiformis, remains unknown. Long–range spread is mainly through planting of infected nursery stock, followed by downstream spread in river water by motile zoospores. The pathogen was on the EPPO alert list from 1996 to 2001.

Taxonomic Tree

Top of page
  • Domain: Eukaryota
  •     Kingdom: Chromista
  •         Phylum: Oomycota
  •             Class: Oomycetes
  •                 Order: Peronosporales
  •                     Family: Peronosporaceae
  •                         Genus: Phytophthora
  •                             Species: Phytophthora alni species complex

Notes on Taxonomy and Nomenclature

Top of page

The presence in Europe of a Phytophthora species causing decline of alder was first reported by Brasier et al. (1995). It was described as a species close to Phytophthora cambivora, but homothallic with a high rate of oospore abortion. Brasier et al. (1999) showed that the alder Phytophthora was a heterogeneous heteroploid entity with a standard type and several variants, in particular a Swedish variant and a Dutch variant. Based on the karyotype and on the presence of frequent overlapping peaks in the electrophoregram of ITS sequences, Brasier et al. (1999) concluded that it was a hybrid with parents not yet identified. The 3 entities were described by Brasier et al. (2004) as the Phytophthora alni complex, comprising Phytophthora alni subspecies alni (Paa, standard type), Phytophthora alni subspecies multiformis (Pam, Dutch variant) and Phytophthora alni subspecies uniformis (Pau, Swedish variant). The variants Pam and Pau were shown to be tightly related to Paa, although their precise nature (genetic breakdown products of the standard hybrid, or products of subsequent back-crosses or inter-crosses) remained undetermined. Subsequent analyses by Ioos et al. (2006) showed that Pau and Pam were the progenitors of Paa rather than variants. This was confirmed by Ioos et al. (2007) and Bakonyi et al. (2007).  Finally, Husson et al. (2015) renamed the 3 entities as 3 different species, P. ×alni, P. ×multiformis and P. uniformis, with P. ×alni being a homoploid hybrid between P. ×multiformis and P. uniformis.

Description

Top of page

A detailed description of the three species of the complex can be found in Brasier et al. (2004); note that the species were renamed by Husson et al. (2015) with additional information on their DNA and confirmation that P. ×multiformis and P. uniformis are the parents of the hybrid species P. ×alni.

The alder phytophthoras are homothallic and produce frequent to abundant oogonia in culture. Sporangia are non-papillate and non-caducous. Chlamydospores are absent.

Species

Monoploid genome size

Inferred karyotype

Colony morphology

Oogonia

Antheridia

P. ×alni

119 Mbp

3 n

uniform, appressed-felty with no or very sparse aerial mycelium

similar to P. cambivora with tapered stalks, variably warty with bullate protuberances

predominantly two-celled and amphigynous

P. uniformis

144 Mbp

2 n

irregular appressed colony with little woolly aerial but submerged growth at the edge

mostly smooth-walled, but some slightly wavy edged-verrucose

consistently two-celled and amphigynous

P. ×multiformis

112 Mbp

4 n

irregular, from mainly submerged to dense white aerial mycelium

wide variety, near smooth to extremely ornamented

wide variety, single celled to two celled amphigynous, occasionally paragynous

Species

Diameter of mature oogonia

Oospore diameters

Antheridial lengths

Antheridial widths

Sporangial length

Sporangial width

Sporangial length/width ratio

P. ×alni

42.8–50 μm

33.3–43.5 μm

23.5–27 μm

18.5–19.5 μm

48–59.8 μm

31.3–42.8 μm

1.32–1.62

P. uniformis

39.8–49 μm

33.3–43.4 μm

19.3–23.5 μm

Similar to P. ×alni

P. ×multiformis

50–60 μm

Similar to P. ×alni

Distribution

Top of page

Phytophthora ×alni

The most common species of the complex is Phytophthora ×alni, which is found across much of Europe. It is presumed to have evolved in Europe from hybridization between P. uniformis and P. ×multiformis (Aguayo et al., 2016). Sweden is one exception to the distribution of P. ×alni -- P. uniformis is prevalent, and P. ×alni is restricted to the southern cost (Redondo et al., 2015). The pathogen has notably not been reported from the Balkans. In southern Europe (Spain, Portugal, and southern Italy) it was reported later and to a lesser extent than further north.

Phytophthora uniformis

P. uniformis occurs sporadically over all the area of P. ×alni presence with a distribution that extends further north in Sweden than P. ×alni (reported about 150 km north of Stockholm -- Redondo et al., 2015). It is reported in the Czech Republic to have a distribution slightly different from that of P. ×alni, being present at higher elevation and in smaller streams (Stepankova et al., 2013); the authors conclude that P. uniformis could be an indigenous species displaced by P. ×alni. However, it is also reported from North America, in Alaska where it is found in the soil at the base of healthy and declining Alnus incana ssp. tenuifolia (Adams et al., 2008), and in Oregon where it is associated with declining A. rubra (Sims et al., 2015). A study of the population structure in both Europe and North America concluded that the pattern suggests that the taxon is indigenous in North America and introduced in Europe (Aguayo et al., 2013).

Phytophthora ×multiformis

P. ×multiformis has a sporadic distribution in Europe, being reported from fewer countries than the other two taxa. It is suggested to be a tetraploid hybrid by Husson et al. (2015). However, its parental species and their region of origin are unknown.

Distribution Table

Top of page

The distribution in this summary table is based on all the information available. When several references are cited, they may give conflicting information on the status. Further details may be available for individual references in the Distribution Table Details section which can be selected by going to Generate Report.

Continent/Country/RegionDistributionLast ReportedOriginFirst ReportedInvasiveReferenceNotes

North America

USAPresentCABI/EPPO, 2008; EPPO, 2014Only P. uniformis
-AlaskaPresentNativeAdams et al., 2008; CABI/EPPO, 2008; Adams et al., 2009; EPPO, 2014Only P. uniformis
-OregonPresentSims et al., 2015Only P. uniformis

Europe

AustriaPresent Invasive Brasier et al., 2004; CABI/EPPO, 2008; EPPO, 2014Possibly invasive. P. ×alni and P. uniformis
BelgiumWidespread1999 Invasive Cavelier et al., 1999; Merlier et al., 2005; CABI/EPPO, 2008; EPPO, 2014P. ×alni, P. uniformis and P. ×multiformis (in Wallonia)
Czech RepublicWidespread Invasive CABI/EPPO, 2008; Cerny et al., 2008; Stepankova et al., 2013; EPPO, 2014P. ×alni widespread and invasive; P. uniformis localized
DenmarkPresentCABI/EPPO, 2008; Redondo et al., 2017P. uniformis
FranceWidespread1996 Invasive Streito et al., 2002; Ioos et al., 2006; CABI/EPPO, 2008; Aguayo et al., 2014; EPPO, 2014P. ×alni widespread and invasive (disease may have been present since 1988); P. uniformis and P. ×multiformis localized
GermanyWidespread1995 Invasive Hartmann, 1995; Brasier et al., 1999; Jung and Blaschke, 2004; CABI/EPPO, 2008; EPPO, 2014; Aguayo et al., 2016P. ×alni widespread and invasive; P. uniformis and P. ×multiformis localized
HungaryWidespread1999 Invasive Szabo et al., 2000; Brasier et al., 2004; Koltay, 2007; CABI/EPPO, 2008; EPPO, 2014P. ×alni (widespread) and P. uniformis (localized)
IrelandPresent Invasive Brasier et al., 2004; CABI/EPPO, 2008; EPPO, 2014P. ×alni
ItalyPresent2000Santini et al., 2001; Brasier et al., 2004; CABI/EPPO, 2008; EPPO, 2014P. ×alni and P. uniformis
LatviaLocalisedEPPO, 2019
LithuaniaPresent2001Brasier et al., 2004; CABI/EPPO, 2008; EPPO, 2014P. ×multiformis
NetherlandsPresent1994Brasier et al., 1999; Brasier et al., 2004; CABI/EPPO, 2008; EPPO, 2014P. ×multiformis first reported 1994; P. ×alni 1996
NorwayLocalised2012Strømeng et al., 2012; Bjelke et al., 2016; Talgø et al., 2018P. ×alni and P. uniformis
PolandPresent2002 Invasive Orlikowski et al., 2003; CABI/EPPO, 2008; EPPO, 2014; Aguayo et al., 2016P. ×alni
PortugalPresent2010 Invasive Kanoun-Boulé et al., 2016P. ×alni
SlovakiaPresentCABI/EPPO, 2008; EPPO, 2014No indication of the species
SloveniaPresentIoos et al., 2006; CABI/EPPO, 2008; EPPO, 2014P. uniformis (isolate of 2003)
SpainLocalised2009 Invasive Pintos Varela et al., 2010; Aguayo et al., 2013; EPPO, 2014P. ×alni (invasive; Galicia and Salamanca regions) and P. uniformis
SwedenWidespread1996 Invasive Brasier et al., 1999; Olsson, 1999; CABI/EPPO, 2008; EPPO, 2014; Redondo et al., 2015P. ×alni (first reported 1996; invasive; only in south); P. uniformis (first reported 1996; invasive; widespread); P. ×multiformis (first reported 2006; localized)
SwitzerlandLocalised Invasive S. Prospero, Swiss Federal Institute for Forest Snow and Landscape Research WSL, Zurich, Switzerland, personal communication, 2018P. ×alni
UKWidespread1993 Invasive Brasier et al., 1995; Brasier et al., 1999; Gibbs et al., 1999; CABI/EPPO, 2008; EPPO, 2014P. ×alni (first reported 1993; widespread and invasive); P. ×multiformis (first reported 1996; localized)
-England and WalesPresentCABI/EPPO, 2008; EPPO, 2014
-ScotlandPresent1993 Invasive CABI/EPPO, 2008; EPPO, 2014

History of Introduction and Spread

Top of page

Very limited information exists on the history of introduction. The alder Phytophthora was first reported in the UK in the early 1990s, and then in the following years across a large part of continental Europe from Sweden to southwestern France. Eastern and southern Europe was reported to be invaded later, after the year 2000. The pathogen appeared to be present only recently in UK sites investigated at the start of the emergence (Gibbs, 1995). Suspicion of presence could be traced to 1987-88 in UK and France and 1983 in the Netherlands (Streito et al., 2002, Streito, 2003). It has been shown that the hybridisation between P. uniformis and P. ×multiformis that led to the emergence of P. ×alni occurred multiple times in Europe (Aguayo et al., 2016). This shapes the structure of the European population of P. ×alni, with the most common cluster of isolates occurring throughout Europe while a less common group occurs specifically in Eastern Europe (Poland, Hungary and eastern Germany). Altogether, it does not appear that P. ×alni was generated in one location and then spread throughout Europe, but rather that the parental species were spread across Europe and that several hybridisation events led to several local disease foci (Aguayo et al., 2016).

A study of the population structure of P. uniformis in both Europe and North America concluded that the pattern suggests that it is indigenous in North America and introduced in Europe (Aguayo et al., 2013). The origin of P. ×multiformis is unknown.

Risk of Introduction

Top of page

The main long distance pathway identified for spread of the alder Phytophthora has been the planting of infected plant material (see the section on Means of Movement and Dispersal). For that reason planting alders presents a high risk of introducing the pathogen at a site.

The pathogen is no longer on the EPPO alert list (although it was from 1996 to 2001), and has not been listed as a quarantine pest.

Another suggested pathway that could move the pathogen to unaffected river systems is the release of fish from contaminated areas (Jung and Blaschke, 2004). However, this pathway appears to be of less importance than the planting of infected plants.

Habitat

Top of page

In the first years of the epidemic, the bulk of infected alders were observed within one metre of the river (Gibbs et al., 1999). This has been less clear in more recent work (see Elegbede et al., 2010) and probably depends on flooding patterns on the banks.

Habitat List

Top of page
CategorySub-CategoryHabitatPresenceStatus
Terrestrial
Terrestrial – ManagedManaged forests, plantations and orchards Principal habitat Harmful (pest or invasive)
Terrestrial ‑ Natural / Semi-naturalNatural forests Secondary/tolerated habitat Harmful (pest or invasive)
Riverbanks Principal habitat Harmful (pest or invasive)
Riverbanks Principal habitat Natural

Hosts/Species Affected

Top of page

Alnus glutinosa is the most frequently affected host in Europe (Streito, 2003). Alnus incana subsp. tenuifolia and Alnus rubra were reported to be the hosts of P. uniformis in Alaska and Oregon, respectively (Adams et al., 2009, Sims et al., 2015). Alnus cordata and A. incana can also be affected.

Growth Stages

Top of page Seedling stage, Vegetative growing stage

Symptoms

Top of page

Symptoms are typical of Phytophthora root and collar diseases on broadleaved trees (see Brasier et al., 1995). This includes sparse foliage with abnormally small yellow leaves, dieback and canker at the base of the main stem. Cankers are typical of so-called ink diseases and very similar to those caused by P. cinnamomi / P. cambivora on oak or chestnut. They are visible externally by sunken dead inner bark stripes that extend from the collar up to about 1m high or more. Black exudates ooze from spots across the canker surface. These tarry spots turn to a rust colour with time. Dead roots may also be present. Infection cannot really be latent; however, depending on the stage of the disease, the host level of resistance or the presence of environmental factors unfavourable to the pathogen, root infections may have limited impact on the appearance of the crown and may thus remain undetected (Elegbede et al., 2010). This can be a serious problem for detecting infected seedlings in nurseries (Jung and Blaschke, 2004).

List of Symptoms/Signs

Top of page
SignLife StagesType
Leaves / abnormal colours
Leaves / abnormal forms
Leaves / wilting
Leaves / yellowed or dead
Roots / reduced root system
Stems / canker on woody stem
Stems / dieback
Stems / discoloration
Stems / ooze
Whole plant / discoloration
Whole plant / dwarfing
Whole plant / plant dead; dieback
Whole plant / seedling blight

Biology and Ecology

Top of page

Genetics

Phytophthora ×alni is a triploid homoploid hybrid between P. uniformis, a diploid Phytophthora species, and P. ×multiformis, a taxon that has itself been reported to be a tetraploid alloploid hybrid (Husson et al., 2015). Chromosome numbers were reported by Brasier et al. (1999): 18-22 for P. ×alni, 15-18 for P. ×multiformis (Dutch / German variants) and 11-13 for P. uniformis. Meiosis is incomplete for P. ×alni and some P. ×multiformis isolates, while it is complete for P. uniformis (Brasier et al., 1999). Oogonia produced in vitro by P. ×alni are often incompletely developed and this species has a high frequency of oosphere abortion (Brasier et al., 1995).

P. uniformis has been reported to have low genetic diversity in Europe with only 3 multilocus genotypes reported in Aguayo et al. (2013) and the dominant one representing 91% of the studied isolates. The genotypic diversity was reported to be 0.18. However, this study worked on a sample of 44 European isolates, more than half of them from north-eastern France. In particular, few isolates from Sweden were analysed although this is the European country where P. uniformis is the most common. It is therefore possible that more diversity occurs in Europe. In North America (Alaska and Oregon), the genotypic diversity was found to be moderate (0.70), with the 27 isolates analysed grouping within 10 multilocus genotypes (Aguayo et al., 2013).

P. ×multiformis diversity in Europe was analysed by Aguayo et al. (2016), who reported 5 multilocus genotypes among the 39 analysed P. ×multiformis isolates and a reported genotypic diversity of 0.59.

Reproductive Biology

P. ×alni spreads mainly asexually, by producing sporangia and zoospores in the soil and on infected primary roots. Zoospores are spread in soil or river water and infect either fine roots or the bark of alder saplings or mature trees (Lonsdale, 2003). A major infection course appears to be via the collar and root collar area of the tree, with the pathogen presumably able to infect unwounded bark through lenticels (Lonsdale, 2003). Infection of the lower bole during flooding events has also been reported (Gibbs et al., 1999). P. ×alni lacks resistant spores: chlamydospores are absent and sexual reproduction has not been shown to be functional. Viability of oospores produced in vitro has been shown to be very low (31-36% -- Delcán and Brasier, 2001). This is in agreement with the low ability to persist in soil -- only a few months in the absence of the host (Jung and Blaschke, 2004; Elegbede et al., 2010) -- indicating that viable oospores might not be produced in soil or root tissues. The lack of functional sexual reproduction is further supported by the clonal population structure of P. ×alni in Europe, with the main multilocus genotypes representing about 80% of the collected isolates and increasing in frequency from 1996 to 2009 (Aguayo et al., 2016).

P. uniformis has different reproductive strategies in Europe and in North America. While the European population was shown to be either strictly clonal or selfing, the genetic structure of the North American population suggested a mixed mating system, including selfing with rare outcrossing (Aguayo et al., 2013). As meiosis was reported to be complete for European isolates of P. uniformis (Brasier et al., 1999), this species should be able to produce viable oospores in Europe and thus should have resistant spores in natural conditions.

Physiology and Phenology

Survival strategies depend on the species in the complex. P. uniformis produces viable oospores and might have a survival strategy similar to many other Phytophthora species, with some ability to survive in soil in the absence of a host. By contrast, as pointed out above, P. ×alni lacks resistant spores and survives poorly in soil in the absence of a host (Jung & Blaschke, 2004; Elegbede et al., 2010). It has been suggested that this species depends on continuous infection of host fine roots to survive and thus shows high susceptibility to adverse environmental conditions (Aguayo et al., 2014; Redondo et al., 2015).

In artificial inoculations, P. ×alni isolates show higher aggressivity than P. uniformis and P. ×multiformis (Brasier and Kirk, 2001). P. uniformis showed quite low aggressivity in these tests. The difference between European and North American isolates of P. uniformis has not been studied. Variability in aggressivity of P. ×alni isolates was studied in vitro by inoculation on pruned Alnus glutinosa twigs (Chandelier et al., 2015). Limited differences were found, with a ratio between the most and least aggressive isolates of about 1.1.

The pattern of activity in the soil has been studied in north-eastern France (Elegbede et al., 2010; Aguayo et al., 2014). P. ×alni was recovered in soil in greater density in spring and was less abundant in summer and autumn. However, this varies significantly between years, and in particular is affected by the occurrence of severe frost in the previous winter. The method used was semi-quantitative by baiting, and did not allow precise estimates of population size in term of propagule numbers per unit volume of soil.

Environmental Requirements

P. ×alni is susceptible both to too hot summers and to too cold winters. Its lower temperature range is the best documented. Its survival was shown to be strongly reduced during periods of heavy frosts (Schumacher et al., 2006). These authors confirmed by in vitro tests that P. ×alni poorly survives periods of 3 days at -5°C and is eliminated by 30 days at -5°C. The frost tolerance of P. ×alni was further studied by Cerny et al. (2012), who reported that recovery after 28 days at -5°C was 12 ± 4% while at -7.5°C the half-survival time was 2 days and no recovery occurred after 21 days. The epidemiological importance of this was confirmed by Thoirain et al. (2007), Cerny and Strnadova (2012), Aguayo et al. (2014) and Redondo et al. (2015). Frost susceptibility of P. ×alni is likely to be the factor that determines its northern limit in Sweden (Redondo et al., 2015) and its lower frequency at higher elevation in north-eastern France (Thoirain et al., 2007) and in the Czech Republic (Stepankova et al., 2013).

The negative impact of high summer temperature is less documented. Aguayo et al. (2014) reported that, in north-eastern and western France, affected A. glutinosa started to recover when the mean temperature in July-August reached values above 18.5-19°C, and the likelihood of decline of healthy alders was reduced at these temperatures.

Other environmental factors have also been reported to affect the alder Phytophthora. Inoculation studies in greenhouses demonstrated that flooding enhanced the severity of P. ×alni infection on A. glutinosa (Strnadová et al., 2010). A correlation between nitrogen pollution of watercourses and the severity of P. ×alni black alder decline was reported by Gibbs et al. (1999), but it was noticed that the more polluted watercourses were also those where P. ×alni was more likely to have been introduced early. This correlation between nitrogen pollution and alder decline severity could not be confirmed by Thoirain et al. (2007).

To compute the range of latitude and annual temperature for the Environmental Requirements table, locations of isolates reported in Aguayo et al. (2016), Redondo et al. (2015) and Kanoun-Boulé et al. (2016) were taken into account and the air temperature range was determined from CHELSA data (CHELSA, 2018).

P. uniformis is found further north and in places with colder climates than P. ×alni and P. ×multiformis, as shown in the tables below:

P. uniformis:

Latitude range

°N (limit or range)

°S (limit or range)

Approximate limits north to south

65.1°

42.3°

Air temperature

Lower limit

Upper limit

Mean annual temperature (°C, lower/upper tolerance limits)

-2.5°C

15°C

Mean maximum temperature of hottest month (°C, lower/upper tolerance limits)

13.5°C

26.5°C

Mean minimum temperature of coldest month (°C, lower/upper tolerance limits)

-24°C

5.5°C

Absolute minimum temperature (°C)

(= minimum lowest temperature tolerated/ever recorded)

Not reported

P. ×alni and P. ×multiformis:

Latitude range

°N (limit or range)

°S (limit or range)

Approximate limits north to south

57.8°

40.1°

Air temperature

Lower limit

Upper limit

Mean annual temperature (°C, lower/upper tolerance limits)

6.5°C

15°C

Mean maximum temperature of hottest month (°C, lower/upper tolerance limits)

16°C

29°C

Mean minimum temperature of coldest month (°C, lower/upper tolerance limits)

-5.0°C

5.5°C

Absolute minimum temperature (°C)

(= minimum lowest temperature tolerated/ever recorded)

-5°C

Climate

Top of page
ClimateStatusDescriptionRemark
Cs - Warm temperate climate with dry summer Preferred Warm average temp. > 10°C, Cold average temp. > 0°C, dry summers
Cf - Warm temperate climate, wet all year Preferred Warm average temp. > 10°C, Cold average temp. > 0°C, wet all year
Ds - Continental climate with dry summer Preferred Continental climate with dry summer (Warm average temp. > 10°C, coldest month < 0°C, dry summers)
Df - Continental climate, wet all year Preferred Continental climate, wet all year (Warm average temp. > 10°C, coldest month < 0°C, wet all year)

Latitude/Altitude Ranges

Top of page
Latitude North (°N)Latitude South (°S)Altitude Lower (m)Altitude Upper (m)
65.1 40.1

Air Temperature

Top of page
Parameter Lower limit Upper limit
Mean annual temperature (ºC) -2.5 15
Mean maximum temperature of hottest month (ºC) 13.5 29
Mean minimum temperature of coldest month (ºC) -24 5.5

Notes on Natural Enemies

Top of page

There are no reported natural enemies of the alder phytophthoras.

Means of Movement and Dispersal

Top of page

Natural Dispersal

Once established in at a site, the pathogen is spread by the means usual for phytophthoras, i.e. movement of water, especially along watercourses, and movement of infected soil by humans and wild animals (Jules et al., 2002; Gibbs et al., 2003; Webber and Rose, 2008; Romportl et al., 2016). The spread is very fast downstream, the water course downstream of an infected site on a river bank being thoroughly colonized in few years (Jung and Blaschke, 2004). Upstream spread is much slower; observational evidence in north-eastern France suggests that it occurs at a rate of one to a few km per year, presumably by transport of contaminated soil by vehicles, humans or animals (B. Marçais, INRA, Nancy, France, unpublished results). The root to root spread via soil was quantified by Elegbede (2011) and found to occur at only a few metres per year.

Vector Transmission (Biotic)

Movement of infected soil is known to be an efficient means of dispersal for many phytophthoras (Weste, 1983). The alder phytophthoras may be transferred locally by wild animals or cattle; Redondo et al. (2015) suggest grazing animals as possible vectors, although this has not been specifically documented.

Accidental introduction

The major pathway for long distance dispersal is plants for planting. The alder phytophthoras have been shown to be often present in nurseries of Europe (Jung and Blaschke, 2004; Schumacher et al., 2005; Jung et al., 2016). Planting of infected nursery material in forest situations or river banks has been demonstrated to enable the establishment of the pathogens, in particular P. ×alni (Jung et al., 2016). Jung and Blaschke (2004) provide a striking example of how entire catchment areas are invaded by that process, the introduced pathogen spreading downstream very fast.

An alternative pathway that could introduce the pathogen in unaffected river systems is the release of fish from contaminated areas. Jung and Blaschke (2004) give some circumstantial evidences that this might have occurred at the beginning of the epidemic in Bavaria. However, the frequency and viability of P. ×alni inoculum in the water released with fish, and on its efficiency in establishing the pathogen in watercourses, are so far not documented.

Movement of infected soil, including that stuck to machinery or people's shoes, is known to be an efficient means of dispersal for many phytophthoras (Weste, 1983), although this has not been specifically demonstrated for the alder Phytophthora (Webber and Rose, 2008).

Seedborne Aspects

Top of page

No evidence of transmission by seed has been reported for the alder phytophthoras.

Economic Impact

Top of page

Economic impact occurs in forestry, in particular in alder plantations. However, there is little data on the magnitude of this impact as most surveys have concerned riparian alders, i.e. populations on river banks. Jung and Blaschke (2004) report the isolation of P. alni sensu lato from 86% of the studied forest plantations in Bavaria in 2001-2002.

Alder is a valuable species in alluvial situations and these sites have been heavily impacted over the years by invasive pests such as Dutch elm disease and ash dieback. The choice of species for forest plantations is not that wide in alluvial sites, and avoiding alder plantations on the ground that nursery stock is often infected by P. ×alni can be difficult in many situations.

Environmental Impact

Top of page

Impact of the disease on river banks has been well documented in Europe (see table), with large scale surveys conducted in several countries (Czech Republic, France, Germany, Hungary, Sweden, United Kingdom). It is however difficult to compare the reported severities because the surveys were done at different stages of the epidemic, usually over short periods, and because the damage scales used are different. In most case the authors conclude that the disease has a high impact. An exception is Koltay (2007) who concludes that the alder Phytophthora epidemic appeared to have reached its peak in Hungary in 2003 and that it remained mild. Disease surveys showed a more critical situation in most European countries where presence of the alder Phytophthora is often massive (75-90% of investigated stands). However, Redondo et al. (2015) report that in Sweden in 2013 only 28% of the observed plots were infected by either P. ×alni (1/3) or P. uniformis (2/3). Aguayo et al. (2014) also report that the decline prevalence may fluctuate strongly with climate, with trees recovering after cold winters or hot summers, which makes the comparison between surveys even more difficult.

Large scale survey on alder Phytophthora prevalence in Europe:

Country

Year

Alder species surveyed

% plots with presence of alder Phytophthora

Global prevalence (% total observed trees declining or dead)

% declining/dead trees in plots with alder Phytophthora presence

Reference

United Kingdom

1996

A. glutinosa

46%

7.9

unreported

Gibbs et al. (1999)

United Kingdom

2003

A. glutinosa

unreported

15.3

unreported

Webber et al. (2004)

Germany (Bavaria)

2001-2002

A. glutinosa
A. incana

90%

unreported

>50% in some watercourses

Jung and Blaschke (2004)

Hungary

2002-2003

A. glutinosa

75%

unreported

<1% in 51% of plots; >20% in 10% of plots

Koltay (2007)

NE France

2004

A. glutinosa

78%

16

unreported

Thoirain et al. (2007)

France (Charente)

1998-2003

A. glutinosa

>80%

60%

unreported

Aguayo et al. (2014)

Sweden

2013

A. glutinosa
A. incana

28%

unreported

40

Redondo et al. (2015)

There is little published information on the effects of the disease on growth and mortality of alder trees. Aguayo et al. (2014) describe a model which includes an estimate of the mortality rate for non-declining and declining alder -- 2.3% of declining alder died annually during a 6-year survey in north-eastern France compared with 0.5% of non-declining ones (although many non-declining alders are in fact infected but asymptomatic -- Elegbede et al., 2010). This moderate mortality rate refers to mature alder; mortality for seedlings is much higher (median survival time of 2 years for alders <2 cm dbh [diameter at breast height] -- B. Marçais, INRA, Nancy, France, unpublished results).

The impact of the disease on ecosystem functioning was reviewed by Bjelke et al. (2016). Alder plays an important role in the riparian ecosystem, providing bank stability by it strong rooting, root habitat structures for some species of fish, and shade that limits warming of the watercourse. Also, it is a nitrogen-rich source of detritus for food webs of this ecosystem. By potentially reducing the frequency of alder on river banks, the disease could have a significant impact on all those ecosystem functions and services. However, as pointed out by Bjelke et al. (2016), the magnitude of the impact really depends on the degree of change in the tree community observed on the river banks, which as yet is not well documented. In a case study reported by Marçais et al. (2015), the A. glutinosa population along 3.5 km of river in north-eastern France did not decrease from 2002 to 2015 in terms of basal area per 100m of bank, despite a very active P. ×alni epidemic.

Differences between the introduced and native range can only be discussed for P. uniformis. It is difficult to assess whether a difference between Europe and North America exists. However, in Sweden where this species is common, it is reported to be associated with declines of A. glutinosa as severe as those induced by P. ×alni (Redondo et al., 2015), whereas in Alaska, Adams et al. (2009) concluded that, although widely present, P. uniformis did not significantly contribute to decline of A. incana subsp. tenuifolia.

The alder phytophthoras do not cause any conservation threat to alder species.

Social Impact

Top of page

Social impact has not been documented.

Risk and Impact Factors

Top of page Invasiveness
  • Proved invasive outside its native range
  • Abundant in its native range
  • Highly mobile locally
  • Reproduces asexually
Impact outcomes
  • Damaged ecosystem services
  • Ecosystem change/ habitat alteration
  • Host damage
  • Negatively impacts forestry
  • Reduced amenity values
Impact mechanisms
  • Pathogenic
Likelihood of entry/control
  • Highly likely to be transported internationally accidentally
  • Difficult to identify/detect as a commodity contaminant
  • Difficult to identify/detect in the field
  • Difficult/costly to control

Uses

Top of page

No human uses of the alder phytophthoras are reported.

Diagnosis

Top of page

The diagnosis in the laboratory can be made either by isolation or by molecular methods. Isolation procedures from bark, soil and water are described by Streito (2003) and are quite standard for diseases of this type.

Specific primers detecting the alder phytophthoras have been developed. The 3 species can be identified following Ioos et al. (2006) with primer pairs TRP-PAU-F/-R, RAS-PAM1-F/-R and RAS-PAM2-F/-R. P. uniformis is detected with TRP-PAU-F/-R, P. ×multiformis with RAS-PAM1-F/-R and RAS-PAM2-F/-R, and P. ×alni with all three primer pairs. These primers have been directly used on infected bark material with detection efficiency comparable to that obtained by isolation (Thoirain et al., 2007).

Primers developed to identify the alder Phytophthora species:

Primer name

Sequence (5’ – 3’)

TRP-PAU-F

GTGCGTCGCTAGCCCATCA

TRP-PAU-R

CGCCTACAGAGCATCATAG

RAS-PAM1-F

AGAGGGATATATTTGAGGTT

RAS-PAM1-R

GTTGGACCCGGGACGGTCTTC

RAS-PAM2-F

AGAGGGATATATTTGCGGCT

RAS-PAM2-R

TCAGCAATCGGAGAGCAAGCT

Detection and Inspection

Top of page

The most common way to detect the alder phytophthoras in natural situations is by examination of stem cankers. Suitable cankers are those starting from the collar area. As from most Phytophthora, the quality of the sample is critical for the success of the isolation; it should in particular be taken from the margin of a fresh lesion. The isolation success is very irregular: on some occasions, whatever the sample, no isolation can be performed. This delayed the diagnosis of the disease in the early years (Streito, 2003) and may be related to the occurrence of severe frosts occasionally eliminating the pathogen from bole lesions (Černý et al., 2012a). In some situation, stem cankers are absent; this was for example, observed in the Charente area in France (B. Marçais, INRA, Nancy, France, unpublished results). In this case, baiting from soil has proved an efficient way to detect the pathogen (Elegbede et al., 2010, Aguayo et al., 2014).

Detection from nursery seedlings has been reported to be difficult as the seedlings often do not present any crown or root symptoms. Jung and Blaschke (2004) describe a method using baiting of seedling rootstock which enabled them to frequently detect the pathogen from apparently healthy seedlings.

Similarities to Other Species/Conditions

Top of page

In culture, P. ×alni or P. uniformis can be confused with P. cambivora, P. cactorum or P. megasperma (similar growth rate and colony morphology; absence of chlamydospores) but P. cambivora is a heterothallic species and antheridia of P. cactorum and P. megasperma are paragynous.

In the field, symptoms are typical of many Phytophthora root diseases. Other Phytophthora are occasionally found in the field causing stem canker in alders, in particular P. plurivora, P. gonopodydes and P. cactorum (Streito, 2003; Jung and Blaschke, 2004; Redondo et al., 2015).

Prevention and Control

Top of page

Due to the variable regulations around (de)registration of pesticides, your national list of registered pesticides or relevant authority should be consulted to determine which products are legally allowed for use in your country when considering chemical control. Pesticides should always be used in a lawful manner, consistent with the product's label.

Prevention

No quarantine was attempted in Europe, as the pathogen was widely distributed when it was first detected (Gibbs, 1995), which together with its efficient spread via watercourses rendered the idea hopeless. Moreover, it has been shown that a significant number of infected alders keep healthy crowns and do not present stem cankers, making it difficult to detect all infected individuals (Elegbede et al, 2010). However, in the absence of curative means to manage the disease, the main tool is prevention. In particular, the major pathway that led to infection of healthy river systems is plants for planting, so it is critical to avoid introducing the pathogen to watercourses in this way. The disease is widely present in European nurseries and there is no certification method for ensuring Phytophthora-free seedlings; avoiding alder planting along watercourses as much as possible is a prevention strategy that would work.

Jung and Blashke (2004) suggest some possible management strategies for tree nurseries: growing alders in fields where no nursery plants have been grown for a certain length of time (a 3‐year rotation between alders is recommended); growing their own alder plants from seed or buying them only from nurseries that grow them according to this code of good practice; not using river or surface water for irrigation; not growing any other nursery plants on the alder fields in order to avoid passive introduction of alder Phytophthora with non-host plants; avoiding the introduction of the pathogen from infested fields via soil particles; and the breeding and planting of resistant alders.

Control

Cultural control and sanitary measures

Coppicing infected alder has been a method advocated for managing the alder Phytophthora (Gibbs, 2003). The aim is not to eliminate the pathogen, as it is in the roots and soil and will presumably not be affected by the coppicing. However, the altered shoot/root ratio and the change in micro-climate and competition level may be expected to enhance the survival of the affected individuals and to be beneficial to the riparian ecosystem. The first results presented by Gibbs (2003) for experiments conducted in the UK and north-eastern France showed that regrowth from coppiced infected stems was frequent and remained healthy for some years after the coppicing; however there is no information on the long-term effects.

Host resistance

Unaffected alders have been observed growing side by side with severely affected ones, suggesting that they may possess natural resistance. The possibility of selecting resistant individuals has been investigated in the European project ECOLIRI. Robust methods to test for alder susceptibility to P. ×alni were developed (Chandelier et al., 2016). In particular, while inoculating wounded excised stem segments of alder with mycelial plugs from P. ×alni culture proved very unreliable (results not reproducible and no correlation with assessment from whole plant inoculation), inoculation of cuttings with leaves dipped in a zoospore suspension proved reliable and reproducible. This method enables the testing of a large number of individuals and is very similar to the method used to select Port Orford cedar resistant to Phytophthora lateralis (Oh et al., 2006).

Chandelier et al. (2016) showed that resistance to P. ×alni exists in A. glutinosa and measured relatively high levels of broad-sense heritability (0.6-0.8), showing the feasibility of selecting black alder resistant to P. ×alni.

Gaps in Knowledge/Research Needs

Top of page

The susceptibility of P. ×alni to high summer temperatures may be critical for southern Europe, particularly in a context of climate warming. It remains insufficiently documented.

The surveys available usually report the prevalence of decline, with no indication of how the size of the alder population has been affected. As pointed out by Bjelke et al. (2016), the impact of the disease on ecosystem functioning will largely depend on its effect on alder population size.

References

Top of page

Adams GC, Catal M, Trummer L, Hansen EM, Reeser P, Worrall JJ, 2008. Phytophthora alni subsp. uniformis found in Alaska beneath thinleaf alders. Plant Health Progress, No.December:PHP-2008-1212-02-BR. http://www.plantmanagementnetwork.org/php/elements/sum2.aspx?id=7094

Adams GC, Catal M, Trummer LM, 2009. Distribution and severity of Alder Phytophthora in Alaska. In: Proceedings of the Sudden Oak Death Fourth Science Symposium (USDA Forest Service General Technical Report PSW-GTR-229) [Proceedings of the Sudden Oak Death Fourth Science Symposium], 29-49.

Aguayo J, Adams GC, Halkett F, Catal M, Husson C, Nagy ZÁ, Hansen EM, Marçais B, Frey P, 2013. Strong genetic differentiation between North American and European populations of Phytophthora alni subsp. uniformis. Phytopathology, 103(2):190-199. http://apsjournals.apsnet.org/loi/phyto

Aguayo, J., Elegbede, F., Husson, C., Saintonge, F. X., Marçais, B., 2014. Modeling climate impact on an emerging disease, the Phytophthora alni-induced alder decline. Global Change Biology, 20(10), 3209-3221. http://onlinelibrary.wiley.com/journal/10.1111/(ISSN)1365-2486 doi: 10.1111/gcb.12601

Aguayo, J., Halkett, F., Husson, C., Nagy, Z. Á., Szigethy, A., Bakonyi, J., Frey, P., Marçais, B., 2016. Genetic diversity and origins of the homoploid-type hybrid Phytophthora × alni. Applied and Environmental Microbiology, 82(24), 7142-7153. http://aem.asm.org/content/82/24/7142.abstract doi: 10.1128/AEM.02221-16

Bakonyi, J., Nagy, Z. Á., Érsek, T., 2006. PCR-based DNA markers for identifying hybrids within Phytophthora alni. Journal of Phytopathology, 154(3), 168-177. doi: 10.1111/j.1439-0434.2006.01079.x

Bakonyi, J., Nagy, Z. Á., Érsek, T., 2007. A novel hybrid with the nuclear background of Phytophthora alni subsp. alni exhibits a mitochondrial DNA profile characteristic of P. alni subsp. uniformis. Acta Phytopathologica et Entomologica Hungarica, 42(1), 1-7. HTTP://www.akkrt.hu/kerdesek/reszletes_hjour.jsp?id=038 doi: 10.1556/APhyt.42.2007.1.1

Bjelke, U., Boberg, J., Oliva, J., Tattersdill, K., McKie, B. G., 2016. Dieback of riparian alder caused by the Phytophthora alni complex: projected consequences for stream ecosystems. Freshwater Biology, 61(5), 565-579. http://onlinelibrary.wiley.com/journal/10.1111/(ISSN)1365-2427 doi: 10.1111/fwb.12729

Brasier, C. M., Cooke, D. E. L., Duncan, J. M., 1999. Origin of a new Phytophthora pathogen through interspecific hybridization. Proceedings of the National Academy of Sciences of the United States of America, 96(10), 5878-5883. doi: 10.1073/pnas.96.10.5878

Brasier, C. M., Kirk, S. A., 2001. Comparative aggressiveness of standard and variant hybrid alder phytophthoras, Phytophthora cambivora and other Phytophthora species on bark of Alnus, Quercus and other woody hosts. Plant Pathology, 50(2), 218-229. doi: 10.1046/j.1365-3059.2001.00553.x

Brasier, C. M., Kirk, S. A., Delcan, J., Cooke, D. E. L., Jung, T., Man In't Veld, W. A., 2004. Phytophthora alni sp. nov. and its variants: designation of emerging heteroploid hybrid pathogens spreading on Alnus trees. Mycological Research, 108(10), 1172-1184. doi: 10.1017/S0953756204001005

Brasier, C. M., Rose, J., Gibbs, J. N., 1995. An unusual Phytophthora associated with widespread alder mortality in Britain. Plant Pathology, 44(6), 999-1007. doi: 10.1111/j.1365-3059.1995.tb02658.x

CABI/EPPO, 2008. Phytophthora alni. [Distribution map]. Distribution Maps of Plant Diseases, October (Edition 1). Wallingford, UK: CABI, Map 1040

Cavelier, M., Claessens, H., Etienne, M., 1999. First record of alder (Alnus glutinosa) Phytophthora in Belgium. (Premier signalement du Phytophthora de l'aulne (Alnus glutinosa) en Belgique). Parasitica, 55(2/3), 63-71.

Cerny K, Gregorova B, Strnadova V, Holub V, Tomsovsky M, Cervenka M, 2008. Phytophthora alni causing decline of black and grey alders in the Czech Republic. Plant Pathology, 57(2):370. http://www.blackwell-synergy.com/doi/full/10.1111/j.1365-3059.2007.01718.x

Cerný, K., Filipová, N., Strnadová, V., 2012. Influence of low temperature and frost duration on Phytophthora alni subsp. alni viability. Forest Systems, 21(2), 337-342. http://www.inia.es/forestsystems doi: 10.5424/fs/2012212-02250

Cerný, K., Strnadová, V., 2012. Winter survival of Phytophthora alni subsp. alni in aerial tissues of black alder. Journal of Forest Science, 58(7), 328-336. http://journals.uzpi.cz/web/JFS.htm

Chandelier, A., Husson, C., Druart, P., Marçais, B., 2016. Assessment of inoculation methods for screening black alder resistance to Phytophthora × alni. Plant Pathology, 65(3), 441-450. http://onlinelibrary.wiley.com/doi/10.1111/ppa.12418/abstract doi: 10.1111/ppa.12418

CHELSA, 2018. Climatologies at high resolution for the earth’s land surface areas. Switzerland: Swiss Federal Institute for Forest, Snow and Landscape Research.http://chelsa-climate.org/

Delcán, J., Brasier, C. M., 2001. Oospore viability and variation in zoospore and hyphal tip derivatives of the hybrid alder Phytophthoras. Forest Pathology, 31(2), 65-83. doi: 10.1046/j.1439-0329.2001.00223.x

Elegbede, C. F., Pierrat, J. C., Aguayo, J., Husson, C., Halkett, F., Marçais, B., 2010. A statistical model to detect asymptomatic infectious individuals with an application in the Phytophthora alni-induced alder decline. Phytopathology, 100(11), 1262-1269. doi: 10.1094/PHYTO-05-10-0140

Elegbede, C.F., 2011. (Développement de méthodes statistiques pour la modélisation des maladies d'origine tellurique en milieu naturel – Application au cas du dépérissement des Aulnes glutineux dû à Phytophtora alni). France: Université de Lorraine.

EPPO, 2014. PQR database. Paris, France: European and Mediterranean Plant Protection Organization. http://www.eppo.int/DATABASES/pqr/pqr.htm

EPPO, 2019. EPPO global database. Paris, France: EPPO.https://gd.eppo.int/

Gibbs, J. N., 1995. Phytophthora root disease of alder in Britain. Bulletin OEPP, 25(4), 661-664. doi: 10.1111/j.1365-2338.1995.tb01118.x

Gibbs, J. N., Lipscombe, M. A., Peace, A. J., 1999. The impact of Phytophthora disease on riparian populations of common alder (Alnus glutinosa) in southern Britain. European Journal of Forest Pathology, 29(1), 39-50.

Gibbs, J., 2003. Management and control of Phytophthora disease of alder. In: Forestry Commission Bulletin,(No.126) . Edinburgh, UK: Forestry Commission. 73-78.

Gibbs, J., Cech, T., Jung, T., Streito, J. C., 2003. Field studies on dissemination of the alder Phytophthora and disease development. In: Forestry Commission Bulletin,(No.126) . Edinburgh, UK: Forestry Commission. 55-64.

Hansen EM, 2012. Phytophthora alni. Forest Phytophthoras, 2(1):3031. http://journals.library.oregonstate.edu/ForestPhytophthora/article/view/alni/2716

Hartmann, G., 1995. Root collar rot of alder (Alnus glutinosa) - a previously unknown fungal disease caused by Phytophthora cambivora. (Wurzelhalsfäule der Schwarzerle (Alnus glutinosa) - eine bisher unbekannte Pilzkrankheit durch Phytophthora cambivora). Forst und Holz, 50(18), 555-557.

Husson, C., Aguayo, J., Revellin, C., Frey, P., Ioos, R., Marçais, B., 2015. Evidence for homoploid speciation in Phytophthora alni supports taxonomic reclassification in this species complex. Fungal Genetics and Biology, 77, 12-21. http://www.sciencedirect.com/science/article/pii/S1087184515000365 doi: 10.1016/j.fgb.2015.02.013

Ioos, R., Andrieux, A., Marçais, B., Frey, P., 2006. Genetic characterization of the natural hybrid species Phytophthora alni as inferred from nuclear and mitochondrial DNA analyses. Fungal Genetics and Biology, 43(7), 511-529. http://www.sciencedirect.com/science/journal/00166480 doi: 10.1016/j.fgb.2006.02.006

Ioos, R., Panabières, F., Industri, B., Andrieux, A., Frey, P., 2007. Distribution and expression of elicitin genes in the interspecific hybrid oomycete Phytophthora alni. Applied and Environmental Microbiology, 73(17), 5587-5597. http://aem.asm.org doi: 10.1128/AEM.00721-07

Jules, E. S., Kauffman, M. J., Ritts, W. D., Carroll, A. L., 2002. Spread of an invasive pathogen over a variable landscape: a nonnative root rot on Port Orford cedar. Ecology, 83(11), 3167-3181. doi: 10.1890/0012-9658(2002)083[3167:SOAIPO]2.0.CO;2

Jung, T., Blaschke, M., 2004. Phytophthora root and collar rot of alders in Bavaria: distribution, modes of spread and possible management strategies. Plant Pathology, 53(2), 197-208. doi: 10.1111/j.0032-0862.2004.00957.x

Jung, T., Downing, M., Blaschke, M., Vernon, T., 2007. Phytophthora root and collar rot of Alders caused by the invasive Phytophthora alni: actual distribution, pathways, and modeled potential distribution in Bavaria. Alien Invasive Species and International Trade, 10, 10-18.

Jung, T., Orlikowski, L., Henricot, B., Abad-Campos, P., Aday, A. G., Aguín Casal, O., Bakonyi, J., Cacciola, S. O., Cech, T., Chavarriaga, D., Corcobado, T., Cravador, A., Decourcelle, T., Denton, G., Diamandis, S., Dogmu?-Lehtijärvi, H. T., Franceschini, A., Ginetti, B., Green, S., Glavendekic, M., Hantula, J., Hartmann, G., Herrero, M., Ivic, D., Jung, M. H., Lilja, A. (et al), 2016. Widespread Phytophthora infestations in European nurseries put forest, semi-natural and horticultural ecosystems at high risk of Phytophthora diseases. Forest Pathology, 46(2), 134-163. http://onlinelibrary.wiley.com/journal/10.1111/(ISSN)1439-0329 doi: 10.1111/efp.12239

Kanoun-Boulé, M., Vasconcelos, T., Gaspar, J., Vieira, S., Dias-Ferreira, C., Husson, C., 2016. Phytophthora × alni and Phytophthora lacustris associated with common alder decline in Central Portugal. Forest Pathology, 46(2), 174-176. http://onlinelibrary.wiley.com/journal/10.1111/(ISSN)1439-0329 doi: 10.1111/efp.12273

Koltay, A., 2007. New results of the research on the Alder Phytophthora disease in Hungarian Alder stands. Acta Silvatica & Lignaria Hungarica, Special, 209-213. http://aslh.nyme.hu/fileadmin/dokumentumok/fmk/acta_silvatica/cikkek/VolE3-2007/24_koltay.pdf

Lonsdale, D., 2003. Phytophthora disease of alder: sources of inoculum, infection and host colonisation. In: Forestry Commission Bulletin,(No.126) . Edinburgh, UK: Forestry Commission. 65-72.

Marçais, B., Husson, C., Nagy, Z., 2015. Long term impact of Phytophthora alni on an alder riparian stand. In: Proceedings of the 7th meeting of the International Union of Forest Research Organization (IUFRO) Working Party S07.02.09: Phytophthoras in forests and natural ecosystems [7th meeting of the International Union of Forest Research Organization (IUFRO) Working Party S07.02.09: Phytophthoras in forests and natural ecosystems], [ed. by Sutton, W., Reeser, P.W., Hansen E.M.]. 59.

Merlier, D. de, Chandelier, A., Debruxelles, N., Noldus, M., Laurent, F., Dufays, E., Claessens, H., Cavelier, M., 2005. Characterization of alder Phytophthora isolates from Wallonia and development of SCAR primers for their specific detection. Journal of Phytopathology, 153(2), 99-107. http://www.blackwell-synergy.com/servlet/useragent?func=showIssues&code=jph doi: 10.1111/j.1439-0434.2005.00936.x

Navarro, S., Sims, L., Hansen, E., 2015. Pathogenicity to alder of Phytophthora species from riparian ecosystems in western Oregon. Forest Pathology, 45(5), 358-366. http://onlinelibrary.wiley.com/journal/10.1111/(ISSN)1439-0329 doi: 10.1111/efp.12175

Oh, E., Hansen, E. M., Sniezko, R. A., 2006. Port-Orford-cedar resistant to Phytophthora lateralis. Forest Pathology, 36(6), 385-394. http://www.blackwell-synergy.com/servlet/useragent?func=showIssues&code=efp doi: 10.1111/j.1439-0329.2006.00474.x

Olsson, C. H. B., 1999. Diagnosis of root-infecting Phytophthora spp. Uppsala, Sweden: Sveriges Lantbruksuniversitet (Swedish University of Agricultural Sciences). 100 pp.

Orlikowski, L. B., Oszako, T., Szkuta, G., 2003. First record of alder Phytophthora in Poland. Journal of Plant Protection Research, 43(1), 33-39.

Pintos Varela, C., Rial Martínez, C., Mansilla Vázquez, J. P., Aguín Casal, O., 2010. First report of phytophthora rot on alders caused by Phytophthora alni subsp. alni in Spain. Plant Disease, 94(2), 273. http://apsjournals.apsnet.org/loi/pdis doi: 10.1094/PDIS-94-2-0273A

Redondo, M. A., Boberg, J., Olsson, C. H. B., Oliva, J., 2015. Winter conditions correlate with Phytophthora alni subspecies distribution in southern Sweden. Phytopathology, 105(9), 1191-1197. http://apsjournals.apsnet.org/loi/phyto doi: 10.1094/PHYTO-01-15-0020-R

Redondo, M. Á., Thomsen, I. M., Oliva, J., 2017. First report of Phytophthora uniformis and P. plurivora causing stem cankers on Alnus glutinosa in Denmark. Plant Disease, 101(3), 512. http://apsjournals.apsnet.org/loi/pdis doi: 10.1094/PDIS-09-16-1287-PDN

Romportl, D., Chumanová, E., Havrdová, L., Pešková, V., Cerný, K., 2016. Potential risk of occurrence of Phytophthora alni in forests of the Czech Republic. Journal of Maps, 12, 280-284.

Santini, A., Barzanti, G. P., Capretti, P., 2001. A new Phytophthora root disease of alder in Italy. Plant Disease, 85(5), 560. doi: 10.1094/PDIS.2001.85.5.560A

Schumacher, J., Leonhard, S., Grundmann, B. M., Roloff, A., 2006. New Alder disease in Spreewald biosphere reserve - causes and incidental factors of an epidemic. Nachrichtenblatt des Deutschen Pflanzenschutzdienstes, 58(6), 141-147.

Schumacher, J., Leonhard, S., Grundmann, B.M., Roloff, A., 2005. Novel alder mortality in the Spreewald biosphere reserve – causes, distribution, consequences and management. (Neuartiges Erlensterben im Biosphärenreservat Spreewald – Ursachen, Verbreitung, Folgen und Gegenmaßnahmen ). Dresden, Germany: Dendro-Institute Tharandt, Technical University Dresden.43 pp.

Sims, L. L., Sutton, W., Reeser, P., Hansen, E. M., 2015. The Phytophthora species assemblage and diversity in riparian alder ecosystems of western Oregon, USA. Mycologia, 107(5), 889-902. http://www.mycologia.org/content/107/5/889.abstract doi: 10.3852/14-255

Štepánková, P., Cerný, K., Strnadová, V., Hanácek, P., Tomšovský, M., 2013. Identification of Phytophthora alni Subspecies in Riparian Stands in the Czech Republic. Plant Protection Science, 49, S3-S10. https://doi.org/10.17221/41/2013-PPS

Streito, J. C., 2003. Phytophthora disease of alder: identification and distribution. In: Forestry Commission Bulletin,(No.126) . Edinburgh, UK: Forestry Commission. 25-38.

Streito, J. C., Legrand, P., Tabary, F., Villartay, G. J. de, 2002. Phytophthora disease of alder (Alnus glutinosa) in France: investigations between 1995 and 1999. Forest Pathology, 32(3), 179-191. doi: 10.1046/j.1439-0329.2002.00282.x

Strnadová, V., Cerný, K., Holub, V., Gregorová, B., 2010. The effects of flooding and Phytophthora alni infection on black alder. Journal of Forest Science, 56(1), 41-46. http://www.cazv.cz

Strømeng, G., Brurberg, M. B., Herrero, M., Couanon, W., Stensvand, A., Børja, I., Talgø, V., 2012. (Phytopthora alni forårsaker sjukdom på or (Alnus spp) i Norge). Bioforsk TEMA, 7(12), 8 pp. http://hdl.handle.net/11250/2451207

Szabó, I., Nagy, Z., Bakonyi, J., Érsek, T., 2000. First report of phytophthora root and collar rot of alder in Hungary. Plant Disease, 84(11), 1251.

Talgø, V., Brandrud, T. E., Nordén, B., Sundheim, L., Solheim, H., 2018. (Phytophthora alni, vurdering av økologisk risiko). In: Fremmedartslista 2018 . Trondheim, Norway: Artsdatabanken.https://artsdatabanken.no/Fab2018/N/3106

Thoirain, B., Husson, C., Marçais, B., 2007. Risk factors for the Phytophthora-induced decline of alder in northeastern France. Phytopathology, 97(1), 99-105. doi: 10.1094/PHYTO-97-0099

Webber, J. F., Rose, J., 2008. Dissemination of aerial and root infecting Phytophthoras by human vectors. In: General Technical Report - Pacific Southwest Research Station, USDA Forest Service,(No.PSW-GTR-214) [ed. by Frankel, S. J., Kliejunas, J. T., Palmieri, K. M.]. Berkeley, USA: Pacific Southwest Research Station, USDA Forest Service. 195-198. http://www.fs.fed.us/psw/publications/documents/psw_gtr214/psw_gtr214_195-198_webber.pdf (Proceedings of the Sudden Oak Death Third Science Symposium, Santa Rosa, California, USA, 5-9 March 2007)

Webber, J., Gibbs, J., Hendry, S., 2004. Phytophthora disease of alder (Information Note - Forestry Commission), Edinburgh, UK: Forestry Commission (No.6 Revised), 1-6.

Weste, G., 1983. Population dynamics and survival of Phytophthora. In: Phytophthora: its biology, ecology and pathology, [ed. by Erwin, D. C., Bartnicki-Garcia, S., Tsao, P. H.]. St. Paul, Minneota, USA: American Phytopathological Society. 237–257.

Links to Websites

Top of page
WebsiteURLComment
EPPOhttps://gd.eppo.int/taxon/PHYTAL
Global register of Introduced and Invasive species (GRIIS)http://griis.org/Data source for updated system data added to species habitat list.
La Cater de Normandiehttp://www.cater-normandie.fr/dossiers-thematiques/phytophthora-de-l-aulne.html
Syndicat de Bassin du Vicoinhttp://portail-bassins-versants.fr/-La-maladie-de-l-aulne-.html
UK Forestry Commissionhttps://www.forestresearch.gov.uk/tools-and-resources/pest-and-disease-resources/phytophthora-disease-of-alder/

Contributors

Top of page

21/12/18 Original text by:

Benoit Marçais, Université de Lorraine/INRA, UMR Interactions arbres/microorganisms, 54000 Nancy, France

Distribution Maps

Top of page
You can pan and zoom the map
Save map