Invasive Species Compendium

Detailed coverage of invasive species threatening livelihoods and the environment worldwide

Datasheet

Liberibacter americanus
(American greening)

Toolbox

Datasheet

Liberibacter americanus (American greening)

Summary

  • Last modified
  • 10 December 2019
  • Datasheet Type(s)
  • Documented Species
  • Pest
  • Preferred Scientific Name
  • Liberibacter americanus
  • Preferred Common Name
  • American greening
  • Taxonomic Tree
  • Domain: Bacteria
  •   Phylum: Proteobacteria
  •     Class: Alphaproteobacteria
  •       Order: Rhizobiales
  •         Family: Phyllobacteriaceae
  • There are no pictures available for this datasheet

    If you can supply pictures for this datasheet please contact:

    Compendia
    CAB International
    Wallingford
    Oxfordshire
    OX10 8DE
    UK
    compend@cabi.org
  • Distribution map More information

Don't need the entire report?

Generate a print friendly version containing only the sections you need.

Generate report

Identity

Top of page

Preferred Scientific Name

  • Liberibacter americanus Texeira et al., 2005

Preferred Common Name

  • American greening

Other Scientific Names

  • Ca. Liberibacter americanus
  • Candidatus Liberibacter americanus

International Common Names

  • English: citrus huanglongbing; South American greening; SPS HLB liberibacter

EPPO code

  • LIBEAM (Liberibacter americanus)

Taxonomic Tree

Top of page
  • Domain: Bacteria
  •     Phylum: Proteobacteria
  •         Class: Alphaproteobacteria
  •             Order: Rhizobiales
  •                 Family: Phyllobacteriaceae
  •                     Genus: Candidatus Liberibacter
  •                         Species: Liberibacter americanus

Notes on Taxonomy and Nomenclature

Top of page

Symptoms of huanglongbing (HLB) were first reported in Sao Paulo state in Brazil in 2004. Leaves with blotchy mottle symptoms characteristic of HLB were tested using PCR primers specific for the HLB 16S rRNA; however, the majority of samples tested negative for HLB. Using primers, universal for prokaryotic 16S rRNA, evidence of infection by a bacterium was obtained. Sequence analysis and phylogeny studies were then used to determine that the amplified gene possessed the oligonucleotide and secondary loop structures of the alpha-Proteobacteria which includes the liberibacters, the group to which the HLB pathogens belong. Gene sequence similarities of 98.4 and 96.0% to 'Ca. L. asiaticus' and 'Ca. L. africanus', respectively, were obtained. This lower similarity was reflected in the phylogenetic tree where the new bacterium did not cluster with the other HLB liberibacters, but in a separate branch. Sequence similarity of the 16S/23S intergenic region between the new bacterium and 'Ca. L. asiaticus' and 'Ca. L. africanus' were 66.0 and 79.5%, respectively. As sequence similarity with Liberibacter species does not vary greatly, this confirmed that the new bacterium is a novel species for which the name 'Candidatus Liberibacter americanus' is proposed (Texeira et al., 2005a).

Description

Top of page The bacteria causing Huanglongbing are restricted to the sieve tubes of the phloem vessels. Electron microscopy studies reveal it possesses the characteristic double membrane cell envelope of the liberibacters (Garnier et al., 1984; Texeira et al., 2005a).

Distribution

Top of page

L. americanus has only been found in Brazil.

Distribution Table

Top of page

The distribution in this summary table is based on all the information available. When several references are cited, they may give conflicting information on the status. Further details may be available for individual references in the Distribution Table Details section which can be selected by going to Generate Report.

Last updated: 23 Apr 2020
Continent/Country/Region Distribution Last Reported Origin First Reported Invasive Reference Notes

Europe

BelgiumAbsentEPPO (2020)
NetherlandsAbsent, Confirmed absent by surveyEPPO (2020)
SloveniaAbsentEPPO (2020)

South America

BrazilPresent, LocalizedEPPO (2020); CABI and EPPO (2007)
-Minas GeraisPresentEPPO (2020)
-ParanaPresentEPPO (2020)
-Sao PauloPresentInvasiveColetta Filho et al. (2005); EPPO (2020)
ParaguayAbsent, Invalid presence record(s)EPPO (2020)

Hosts/Species Affected

Top of page

The pathogen has only been detected from sweet orange (Citrus sinensis) and Murraya paniculata.

Growth Stages

Top of page Flowering stage, Fruiting stage, Seedling stage, Vegetative growing stage

Symptoms

Top of page Initial symptoms appear as leaf mottling and chlorosis often occurring in one shoot or sector of the tree. Later leaf symptoms resemble nutritional deficiencies (Zn, Ca and N). Later stages of the disease can cause severe damage to citrus plants including twig dieback, decline and death (Coletto-Filho et al., 2004). The disease frequently produces small, lopsided fruit with aborted seeds (Coletta-Filho et al., 2005).

List of Symptoms/Signs

Top of page
SignLife StagesType
Fruit / abnormal shape
Leaves / abnormal colours
Leaves / abnormal patterns
Leaves / yellowed or dead
Seeds / shrivelled
Whole plant / early senescence
Whole plant / plant dead; dieback

Biology and Ecology

Top of page

The American liberibacter can be detected by the PCR amplification of the 16S rRNA gene in Diaphorina citri, the Asian citrus psyllid suggesting that this insect is the vector of the disease. It can also be transmitted by graft inoculations under greenhouse conditions. Inoculated seedlings displayed the typical blotchy mottle symptoms on the foliage. Electron microscopy studies of the organism confirm that it is restricted to the sieve tubes of the phloem tissue and possesses the characteristic double membrane cell envelope of the liberibacters (Garnier et al., 1984; Texeira et al., 2005a). The organism could not be cultured and specific PCR primers for the disease have been developed (Coletta-Filho et al., 2005; Texeira et al., 2005a).

Means of Movement and Dispersal

Top of page

Vector transmission

The disease organism has been detected in the Asian citrus psyllid, Diaphorina citri, suggesting this is the vector of the disease (Texeira et al., 2005a).

Agricultural practices

The disease is graft transmissible under glasshouse conditions (Texeira et al., 2005a).

Plant Trade

Top of page
Plant parts liable to carry the pest in trade/transportPest stagesBorne internallyBorne externallyVisibility of pest or symptoms
Leaves Yes Pest or symptoms usually invisible
Seedlings/Micropropagated plants Yes
Stems (above ground)/Shoots/Trunks/Branches Yes Pest or symptoms usually invisible
Plant parts not known to carry the pest in trade/transport
Bark
Bulbs/Tubers/Corms/Rhizomes
Flowers/Inflorescences/Cones/Calyx
Fruits (inc. pods)
Growing medium accompanying plants
Roots
True seeds (inc. grain)
Wood

Wood Packaging

Top of page
Wood Packaging not known to carry the pest in trade/transport
Loose wood packing material
Non-wood
Processed or treated wood
Solid wood packing material with bark
Solid wood packing material without bark

Impact Summary

Top of page
CategoryImpact
Animal/plant collections None
Animal/plant products None
Biodiversity (generally) None
Crop production Negative
Environment (generally) None
Fisheries / aquaculture None
Forestry production None
Human health None
Livestock production None
Native fauna None
Native flora None
Rare/protected species None
Tourism None
Trade/international relations Negative
Transport/travel None

Impact

Top of page The economic impact of the disease is hard to determine at such an early stage. In other areas where Huanglongbing occurs, particularly Asia, significant reductions in citrus culture have occurred.

Diagnosis

Top of page

Two PCR methods have been developed to detect the disease, both target the 16S rDNA region of the causal agent. Total DNA is first extracted from leaf midribs.

Primers GB1 (aag tcg agc gag tac gca agt act) and GB3 (cca act taa tga tgg caa ata tag) with reaction conditions of 35 cycles each at 94°C for 45 s, 64°C for 45 s and 72°C for 60 s. These primers lead to a 1027 bp amplicon (Texeira et al., 2005b).

The second lot of primers target what is considered by the authors to be the South American Liberibacter. PCR primers, LSg2f (TTAAGTTAGAGGTGAAATCC) and LSg2r (CAACTTAATGATGGCAAATA) generate a 545 bp amplicon. PCR reactions are performed in 25 µl reaction mixes containing (10 mM Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2) 2 mM each DNTP, 1 unit of Taq DNA polymerase, 5 µl of DNA extract and 20 ng of each primer. PCR reaction conditions consisted of a first step at 94°C for 3 min followed by 36 cycles of a denaturation step at 94°C for 30 s, an annealing step of 55°C for 45 s, extension at 72°C for 45 s and a final extension of 10 min at 72°C. The amplified DNA was analysed in agarose gel electrophoresis and stained with ethidium bromide. The presence of 545 bp amplicon indicates the presence of the causal agent of the disease (Coletta-Filho et al., 2005).

A diagnostic protocol for Liberibacter africanus, Liberibacter americanus and Liberibacter asiaticus and for their detection in their psyllid vectors Diaphorina citri and Trioza erytreae has been published by EPPO (2014). The protocol involves detection based on the disease symptoms and molecular tests (PCR), and reporting and documentation.

Detection and Inspection

Top of page Huanglongbing is difficult to recognize due to symptoms of the disease resembling those of other citrus disorders (see Symptoms). If suspected, the presence of the disease should be confirmed by identifying the bacterium by PCR or electron microscopy.

Similarities to Other Species/Conditions

Top of page

Disease symptoms are almost identical and can be confused with those of the other strains of Liberibacter causing HLB. Mixed infections of two of the strains have been reported (Coletta-Filho et al., 2005). Leaf symptoms also resemble nutrient deficiencies, particularly zinc, calcium and nitrogen.

References

Top of page

CABI/EPPO, 2007. Candidatus Liberibacter americanus. Distribution Maps of Plant Diseases, No. 995. Wallingford, UK: CAB International

Coletta-Filho H, Takita M, Targon M and Machado M, 2005. Analysis of 16S rDNA sequences from citrus Huanglongbing bacteria reveal a different ’Ca. Liberibacter’ strain associated with citrus disease in São Paulo. Plant Disease, 89:848852

Coletta-Filho H, Targon M, Takita M, De Negri J, Pompeu J, Machado M, 2004. First report of the causal agent of Huanglongbing (’Candidatus Liberibacter asiaticus’) in Brazil. Plant Disease, 88:12

EPPO, 2014. PM 7/121 (1) 'Candidatus Liberibacter africanus', 'Candidatus Liberibacter americanus' and 'Candidatus Liberibacter asiaticus'. Bulletin OEPP/EPPO Bulletin, 44(3):376-389. http://onlinelibrary.wiley.com/journal/10.1111/(ISSN)1365-2338

EPPO, 2019. EPPO Global Database. Paris, France: EPPO.https://gd.eppo.int/

Texeira D, Saillard C, Eveillard S, Danet J, da Costa P, Ayres A, Bove J, 2005. ’Candidatus Liberibacter americanus’, associated with citrus Huanglongbing (greening disease) in São Paulo State, Brazil. International Journal of Systematic and Evolutionary Microbiology, 55:1875-1862

Distribution Maps

Top of page
You can pan and zoom the map
Save map